'Sticky' presentation slideshows

694 views • 34 slides

Test Preparation

653 views • 19 slides

Chapter 4.9

Chapter 4.9. Cell Surface Specializations. AP Biology Fall 2010 . Objectives. Understand the difference between primary and secondary cell walls Describe the extra cellular matrix Distinguish between the different cell junctions in plant and animal cells . Eukaryotic Cell Walls.

364 views • 18 slides

Chapter 23 (Part 1)

Chapter 23 (Part 1). Recombinant DNA Technology. Cloning Vector. Required features Origin of replication Selectable marker Screenable marker for recombinant molecules Cloning sites. AAGATGC GAATTC GTACA. AAGATGC GAATTC GTACA. DNA methylase. DNA methylase. *. *. AAGATGC GAATTC GTACA.

265 views • 17 slides

3 Stages of Cricket Materials

281 views • 17 slides

Biotechnology

Biotechnology . Chapter 13. Recombinant DNA . Tools used Restriction enzymes Gel electrophoresis DNA ligase. Restriction enzymes. Cut double stranded DNA into smaller fragments restriction sites Sticky ends Blunt ends . Gel electrophoresis. Separate and purify DNA fragments

270 views • 17 slides

Monday, October 13, 2008 Chapter 9, Part II (of III)

Monday, October 13, 2008 Chapter 9, Part II (of III). Assignment : Chapter 9 problems 1-4, 6, 9, 16, 20, 25, 26, 32 Chapter 7 problems due this week and QUIZ!. Cloning. Molecular Cloning. Step 1: Ligation of DNA into vectors Sticky ends Different types of vectors Step 2: Transformation

1.09k views • 16 slides

Consistence of the Soil

Consistence of the Soil. GES 394 Revised by Mr. Brian Oram http://www.water-research.net. WHAT IS Consistency ?.

941 views • 16 slides

Consistence of the Soil

Consistence of the Soil. GES 394 Revised by Mr. Brian Oram http://www.water-research.net. WHAT IS Consistency ?.

1.84k views • 16 slides

This Tongue Gets a Grip by Mariana Relos

830 views • 14 slides

DENT 1200 Dental Materials

DENT 1200 Dental Materials . Lesson 8 WAXES. 1. Ingredients, Form, Use, Melting. Processing waxes- Boxing, Utility, Sticky Pattern waxes- Inlay/Casting, Baseplate Impression waxes- Bite registration, Study.

270 views • 14 slides

British Cuisine

British Cuisine. Meals and Meal Times . 3 main meals a day: Breakfast - between 7:00 &9:00 , Lunch - between 12:00 &13:30 Dinner -The main meal between 18:30 & 20:00 Tea- time - 16:00. Traditional English Breakfast . Typical English Breakfast . Dinner.

425 views • 14 slides

Computer Systems

208 views • 14 slides

LOLLIPOPS

LOLLIPOPS. By: Cindy. Who invented it. The person who invented the lollipop Is Samuel Born . He was a Russian immigrant. How it got its name??. The name lollipop comes from George Smith which his favorite horse name is lollipop so the name lollipop comes from a horse. What is a lollipop??.

389 views • 13 slides

Restriction Endonucleases

Restriction Endonucleases. BIO450. Restriction Enzymes. Enzymatic Activity Biological Role Diversity Recognition Sequence Digestion Conditions Typical Reaction Double Digest Class Project Computer Analysis. Enzyme Activity. Scanning. GGACGCTAGCTGAT GAATTC GCATCGGATCCGAATCCGCTCTTTCAA

688 views • 12 slides

A Story, A Story

A Story, A Story. Genre: Folktale

288 views • 12 slides

Restriction Enzymes and DNA Fingerprinting

Restriction Enzymes and DNA Fingerprinting. Molecular Scissors for Cutting DNA Precisely. Its because of these biological catalysts that genetic engineering is possible Restriction enzymes can also be called Endonucleases . Types of Restriction Enzymes. Type I

1.15k views • 11 slides

Discovery and Federated Identity

Discovery and Federated Identity. Topics. Life today and the pull-down list from Hell Hints at the wrong layer suck The importance of keeping the continuity of experience Staying with the story How does the likely path of interfederation affect discovery. Life Today. Workarounds

247 views • 11 slides

Introduction to Bioinformatics

Introduction to Bioinformatics. Molecular Biology Tools. Cut and Paste. Restriction enzyme Protein cuts double-stranded DNA molecules at a specific string of nucleotides called restriction site Example Eco RI 5'-GAATTC-3'

195 views • 9 slides

150 views • 7 slides