1 / 18

12-1 DNA

12-1 DNA. Pg. 287. A. Griffith finds a ‘transforming principle.’. 1. Griffith experimented with the bacteria that cause pneumonia. 2. He used two forms: the S form (deadly) and the R form (not deadly). A. Griffith finds a ‘transforming principle.’.

sandra_john
Download Presentation

12-1 DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. 12-1 DNA Pg. 287

  2. A. Griffith finds a ‘transforming principle.’ • 1. Griffith experimented with the bacteria that cause pneumonia. • 2. He used two forms: the S form (deadly) and the R form (not deadly).

  3. A. Griffith finds a ‘transforming principle.’ • 3. A transforming material passed from dead S bacteria to live R bacteria, making them deadly.

  4. A. Griffith finds a ‘transforming principle.’ • 3. A transforming material passed from dead S bacteria to live R bacteria, making them deadly.

  5. B. Avery identified DNA as the transforming principle. • 1. Avery isolated and purified Griffith’s transforming principle. • 2. Avery performed three tests on the transforming principle.

  6. a. Qualitative tests showed DNA was present. • b. Chemical tests showedthe chemical makeupmatched that of DNA. • c. Enzyme tests showedonly DNA-degradingenzymes stoppedtransformation.

  7. C. Hershey and Chase confirm that DNA is the genetic material. • 1. Hershey and Chase studied viruses that infect bacteria, or bacteriophages. • a. They tagged viral DNA with radioactive phosphorus. • b. They tagged viral proteins with radioactive sulfur. • 2. Tagged DNA was found inside the bacteria; tagged proteins were not. video

  8. phosphate group nitrogen-containing base deoxyribose (sugar) D. The Components and Structure of DNA • 1. DNA is composed of four types of nucleotides. • 2. DNA is made up of a long chain of nucleotides. • 3. Each nucleotide has three parts. • a phosphate group • a deoxyribose sugar • a nitrogen-containing base

  9. D. The Components and Structure of DNA • 4. DNA stands for DEOXYRIBONUCLEIC ACID!

  10. 5. The nitrogen containing bases are the only difference in the four nucleotides.

  11. E. Watson and Crick determined the three-dimensional structure of DNA by building models. • 1. They realized that DNA is a double helix that is made up of a sugar-phosphate backbone on the outside with bases on the inside.

  12. G C A T F. Nucleotides always pair in the same way. • 1. The base-pairing rules show how nucleotides always pair up in DNA. • A pairs with T • C pairs with G • 2. Because a pyrimidine (single ring) pairs with a purine (double ring), the helix has a uniform width.

  13. Match the Nitrogen bases! • A • T • C • G • G • C • T • A • T • A • G • C • C • G • A • T

  14. G. Watson and Crick’s discovery built on the work of Rosalind Franklin and Erwin Chargaff. • 1. Franklin’s x-ray images suggested that DNA was a double helix of even width. • 2. Chargaff’s rules stated that A=T and C=G.

  15. covalent bond hydrogen bond • 3. The backbone is connected by covalent bonds. • 4. The bases are connected by hydrogen bonds.

  16. Can you Find the CRIMINAL? • Fingerprints were found at a crime scene with the following DNA code? • ATTACGGCATTATTGCATTAGA • Who is Guilty??? • 1- TAAGCCATAGCGCATATATTTAT • 2- TAATGCCGTAATAACGATAGTA • 3- TAATGCCGTAATAACGTAATCT

More Related