samira
Uploaded by
20 SLIDES
316 VIEWS
200LIKES

Exploring PCR and Gel Electrophoresis: Techniques in DNA Technology

DESCRIPTION

This module covers essential biotechnological techniques, specifically Polymerase Chain Reaction (PCR) and gel electrophoresis. PCR is a method to copy and amplify minute amounts of nucleic acid, while gel electrophoresis separates fragmented DNA pieces based on charge and size. These techniques play critical roles in DNA profiling, forensics, and genetic engineering, paving the way for innovations like genetically modified organisms and advancements in gene therapy. Discover the significance of these technologies in modern biology and their implications for forensic science and genetic research.

1 / 20

Download Presentation

Exploring PCR and Gel Electrophoresis: Techniques in DNA Technology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Syllabus Notes 3.4 3.4.1 State that PCR (polymerase chain reaction) copies and amplifies minute quantities of nucleic acid. 3.4.2 State that gel electrophoresis involves the separation of fragmented pieces of DNA according to their charge and size. 3.4.3 State that gel electrophoresis of DNA is used in DNA profiling.

  2. Samurai Pizza Cats Hour 2’s Random Show of the Day

  3. Gel Electrophoresis, DNA Technology:More than police justice

  4. DNA Technology Forensics Gene Therapy Genetic Engineering Rabbit, mice and fish with the firefly ‘glow gene’ luciferase added.

  5. Old fashioned methods of genetic engineering yielded things like the liger, male lion + female tiger: Before Electrophoresis: Mate Crosses

  6. Before Electrophoresis: Landmarks Genetically engineered insulin used/approved-1982 Genetically engineered organisms began to be patented in 1981 1978-Invitro-Fertilization led to a baby

  7. Before Electrophoresis: More Landmarks 1998: Cloning of stem cells (cells that are not differentiated yet) led to tissue regeneration, and organ culture 1992: FlavrSavr tomato, engineered to ripen/rot slower. Company is now with Monsanto. 1997: First mammal cloned (Dolly the sheep)

  8. Before Electrophoresis: More Landmarks 1990: Human Genome Project launched. Goal: code the entire human genome by 2005 (done way ahead of schedule – 2000.) 1986: DNA fingerprinting developed by Alec Jeffreys 1989: Bacteria with plasmids that can digest oil are used to clean up the Exxon Valdez oil spill.

  9. Electrophoresis: The Basics Procedure used to separate molecules – most commonly proteins and nucleic acids. Uses a gel and an electric current to separate molecules by size or charge. http://learn.genetics.utah.edu/units/biotech/gel/

  10. ( – ) ( – ) ( – ) Electrophoresis: How & why it works ( – ) Phosphate groups make nucleic acids negatively charged. In an electric field, the negative anode repels them and the positive cathode attracts them. Smaller fragments move farther and faster than slower, larger fragments.

  11. Electrophoresis: Good to know kb = kilobase-pairs, or 1,000 base pairs It is used to describe the number of base-pairs in the DNA fragments. Example: 4.36 kb = 4,360 base-pairs Smaller fragments are further down than large fragments.

  12. Electrophoresis: Restriction Enzymes If someone’s DNA is cut with a restriction enzyme, it will make fragments specific to that individual. EcorI, a commonly used restriction enzyme, cuts where ever GAATTC is found. We may find this region: 5 times in an earthworm; or 15 times in a bacteria. We get different lengths between individuals as well as different numbers of fragments.

  13. Ecor I Restriction Enzyme cuts between the ‘G’ and the ‘A’ Whenever the sequence is ‘GAATTC’ Electrophoresis: Restriction Enzymes Makes ‘sticky ends’

  14. Electrophoresis: Restriction Enzymes This is the concept behind adding a gene from one organism into another one. If you cut out a gene using a restriction enzyme, you can make an opening in the DNA of the new organism with the same restriction enzyme.

  15. SmaI cuts between the ‘C’ and the ‘G’ whenever ‘CCC|GGG’ are in a sequence. How does this make a ‘blunt’ end? Electrophoresis: Restriction Enzymes AATTGGAACCCGGGTTCCAAG TTAACCTTGGGCCCAAGGTTC

  16. There are a bunch of different enzymes we can use, each cutting in their own unique way.If we cut with the same DNA with different enzymes, we’ll get a picture like this one. Electrophoresis: Restriction Enzymes

  17. Electrophoresis: RFLPs “Restriction Fragment Length Polymorphism” Definition: a technique in which organisms may be differentiated by analysis of patterns by the cleavage of their DNA. Two organisms differing in distances between cleavage sites will produce different length fragments! Similarities in patterns generated can be used to differentiate the two.

  18. Electrophoresis: CSI SW We can match identities by putting multiple people on the same gel.

  19. Electrophoresis: CSI SW – Ain’t yo daddy… In each of these cases, is the alleged father really the father? (These gel have been simplified.) Remember: each parent donates ½ the genes!

  20. Electrophoresis: Activity • Carefully follow the instructions to the restriction enzyme activity. Only do Part One! • Turn in: • Answers to the lab questions • Your labeled and cut DNA slips (staple them to your answer sheet) • Reminder: • Make-up point work is due tomorrow (Friday)

More Related