1 / 23

Ch. 26 Phylogeny and the Tree of Life

Ch. 26 Phylogeny and the Tree of Life. Is this basic “tree of life” a fact? If so, why? If not, what is it?. Opening Discussion:. Appreciate the enormous diversity and complexity of life on Earth. There are 1.8 million named species. … a fraction of the 10 – 100 million extant species.

pherold
Download Presentation

Ch. 26 Phylogeny and the Tree of Life

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Ch. 26 Phylogeny and the Tree of Life

  2. Is this basic “tree of life” a fact? If so, why? If not, what is it? Opening Discussion:

  3. Appreciate the enormous diversity and complexity of life on Earth. There are 1.8 million named species.... …a fraction of the 10 – 100 million extant species.

  4. Phylogeny = the evolutionary history of a species or group of species • Taxon = named taxonomic unit at any level of the hierarchy Write down the hierarchical classification system: What is the binomial nomenclature?

  5. What goes into phylogeny? • Systematics data • Homologies: similarities due to shared ancestry Linnaeus, 1707- 1778

  6. Phylogenetic trees • Clade = a group of species that includes an ancestral species and all of its descendants • Monophyletic Group

  7. Monophyletic vs Polyphyletic & Paraphyletic

  8. Phylogenetic trees • Shared ancestral trait • Shared derived trait • Node • Sister taxa

  9. A B What are the: Shared Ancestral Traits? Shared Derived Traits? C D

  10. How to tell how to make the tree? • Parsimony = logical principle that the most likely explanation is the one that implies the least amount of change • (Simplest answer is most likely true)

  11. Genetic & Molecular homologies • Biotechnology revolution of late 20th century has given us new type of homology • Universal code: All lifeforms share certain molecular traits e.g., similarities in hemoglobin molecule

  12. Actual sequence of nucleotides for the "leptin" gene for Mouse, Chimpanzee and Human: First 60 nucleotides: M gaggga tcc ctgctccagc agctgcaagg taaggcccggggcgcgctact ttctcctcca C gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct H gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct Nucelotides 121-180: C: agtcaggagg gaggcagggc ggatggctta gttctggact atgatagctt tgtaccgagt H: agtcaggagg gatgcagggc ggatggctta gttctggact atgatagctt tgtaccgagt (National Center for Biotechnology Information)

  13. Evidence from Molecular Biology • When confirm previous conclusions --COHERENCE • Can use molecular homologies when other approaches not possible e.g., similarities in cytochrome c protein

  14. How to tell how to make the tree? • Which tree(s) is/are parsimonious and likely? • Maximum Parsimony • Maximum Likelihood

  15. Molecular Clock • Method for estimating the time of evolutionary change, based on genes that evolve at constant rates • # nucleotide substitutions is proportional to elapsed time since species diverged from common ancestor • Compare number of genetic differences with known evolutionary dates from fossil record to calibrate • Average rate of genetic change can estimate date of divergence events unknown from fossils

  16. Molecular Clock 1 bp changes per 25 million years = 100 million years of evolution occurring between the 2 species (4*25) = 50 million years each 50 my since the common ancestor #bps/rate/2 = time since divergence 4 base pairs different Diagram: evolution.berkeley.edu

  17. The figure shows an analysis of the evolution of the hemoglobin protein in vertebrates from sharks to humans. The straight line indicates that the evolution has occurred at a constant rate. According to the graph, on average, approximately18% of amino acids change in hemoglobin per 100 million years. What percentage change per1 million years?

  18. According to the fossil record, orangutans and African apes diverged 13 million years ago. Based on the average rate shown, calculate the expected percent difference in hemoglobin between orangutans and African apes.

  19. Bonobos and common chimpanzees are the closest extant relative to humans. Given that they only have a 0.468% difference in hemoglobin amino acid sequence, use the average rate of amino acid changes (from above) to calculate the time since divergence.

  20. Homology vsHomoplasy • Convergent evolution: Adaptation by members of different lineages to similar environment • Homoplasy = similar analogous structures that arose independently, without shared ancestry

  21. Ocotillo (NA) Allaudia (Madagascar) Homoplasy • Ichthyosaur & dolphin

  22. Evolutionary History of Genome Change Homologous Genes: Orthologous genes Paralogous genes

More Related