550 likes | 851 Views
Phylogeny & the Tree of Life. AP Biology Ch. 26. Life on Earth. We have identified 2 million species on Earth We believe that ~9 million species exist. http://discovermagazine.com/2012/jan-feb/63. Tree of Life. http://www.utexas.edu/features/2008/tree/. New Species.
E N D
Phylogeny & the Tree of Life AP Biology Ch. 26
Life on Earth • We have identified 2 million species on Earth • We believe that ~9 million species exist http://discovermagazine.com/2012/jan-feb/63
Tree of Life http://www.utexas.edu/features/2008/tree/
New Species • Scientists find new organisms all the time. • How should we name and classify these species?
What is taxonomy? • Taxonomists: • scientists that identify, classify & name organisms
18th century taxonomist Developed naming system still used today Binomial nomenclature Carolus Linnaeus1707 – 1778
binomial nomenclature • Each species receives: • Two-word name (genus & specific epithet) • Capitalize genus, but NOT specific epithet • Written in Latin (sometimes Greek) • Italicized Turdus migratorius
Polar Bear nomenclature • The polar bear’s scientific name is Ursus maritimus • The first part of the name represents the Genus to which the organism belongs. • Genus is a group of closely related species. • The second part of the name is unique to each species within the genus and is called the specific epithet. • maritimus is a latin word referring to the sea. • To say the species of the animal you say the Genus and the specific epithet, so for the polar bear the Genus is Ursus, but the species is Ursus maritimus
But Wait… • Everyone calls that the American Robin! • This is its common name • If we only used common names this would be a • Gato • Cat • Kitten • And so on…
So what? • Who cares if different people call an organism different names? • Penicilliumchrysogenum – treats infection • Penicilliummarneffei – kills you • Big difference
Once we have a name… • Classification: • arrangement of organisms into orderly groups based on their similarities
Taxon (Taxa-plural) • category into which related organisms are placed
Hierarchy of Taxa BROADEST TAXON • Domain • Kingdom • Phylum (Division – used for plants) • Class • Order • Family • Genus • Species (Genus & specific epithet) SPECIFIC TAXON
Basis for Taxonomy • Fossil Evidence • Morphological Evidence • DNA Evidence • The evidence for evolution
DNA evidence Fusion? http://blogs.discovermagazine.com/loom/2012/07/19/the-mystery-of-the-missing-chromosome-with-a-special-guest-appearance-from-facebook-creationists/
You are now a field taxonomist How to Identify Known Species On your first day you see this bird! What Joy!!! Now what bird is this?
Tough Job? • ~700 birds live in the United States • At first this might seem too challenging, however…
Dichotomous Keys • An easy way to sort information • Uses a series of yes or no questions to get to a single description that applies to only one item • How all living things can be identified. • “Dichotomous” means “divided into two parts”. Therefore, dichotomous keys always give two choices in each step.
Partial Dichotomous Key for Sparrows • 1a. Small bird with brown and gray feathers……………………………....…go to 2 • 1b. Small bird with dark gray and white feathers…….…………………… go to 5 • 2a. Bird with solid red cap…………………………………………………….…………..……..3 • 2b. Bird with white and black striped cap……………………………..…………………4 • 3a. Bird with one white stripe on above eye………………….chipping sparrow • 3b. Bird with gray chest……………………………………………..………….tree sparrow • 4a. Bird with yellow spot above eye…….……….………white-throated sparrow • 4b. Bird with no yellow spot above eye………………..white-crowned sparrow • 5a. Bird with pink bill……………. Dark-eyed Junco • 5b. Bird with white wings………………………go to 6
Following a dichotomous key is similar to playing a game of GUESS WHO? • “is your person a boy?”
Hints for Using D.K. • Always, Always, Always start at the beginning • Always read both choices • Be sure you understand the meaning of terms involved. • Do not guess. http://www.execulink.com/~ekimmel/dichotomous_bugs.swf INTERACTIVE PRACTICE
Phylogeny & Systematics AP Biology Ch 26.2 - 26.5
Pedigrees Show family relationships
Phylogeny The evolutionary history of a species
Cladograms Aka: Phylogenetic tree showing relationships These are hypotheses using all available data
Characteristics (primitive & **derived**) Opposable thumbs Synapomorphies are features that are shared among a group of organisms. Automorphies are features that are unique to one type of organism.
Ingroup & Outgroup In: Group of study (make comparisons) Out: Group that diverged prior to ingroup
Monophyletic Group A.K.A. clade Consists of an ancestral group and all its descendants
Paraphyletic Group Group that consists of an ancestral species and some, but notAll, of its descendants
Polyphyletic A group composed of a collection of organisms in which the most recent common ancestor of all the included organisms is not included, usually because the common ancestor lacks the characteristics of the group. No most recent common ancestor An example of a polyphyletic group is bats and birds: both have wings, but they have evolved separately.
Making a cladogram Determine all organisms to be studied Analyze all shared characters Arrange the characters in a table Determine ancestry Construct your cladogram
Maximum Parsimony When designing a phylogenic tree, scientists use the approach of maximum parsimony (simplest explanation is best) In other words, the phylogenetic tree involving the FEWEST evolutionary changes. The most likely tree wins Which one is best?
DNA documentation • With ability to sequence DNA, we can easily show evolutionary relationships • EX: • Species 1: GAGATCTACACGGGGCCATGGAAAG • Species 2: GAGAACTACACGGGGCTATGGAAAG • Species 1: GAGATCTACACGGGGCCATGGAAAG • Species 3: GCCCACTATTATGGGCTATGGACCC
Showing Human Evolution http://www.pbs.org/wgbh/nova/neanderthals/mtdna.html http://www.archaeology.org/9609/abstracts/dna.html http://www.ornl.gov/sci/techresources/Human_Genome/elsi/humanmigration.shtml#2
From Two Kingdoms to Three Domains • Early taxonomists classified all species as either plants or animals • Later, five kingdoms were recognized: Monera (prokaryotes), Protista, Plantae, Fungi, and Animalia • More recently, the three-domain system has been adopted: Bacteria, Archaea, and Eukarya • The three-domain system is supported by data from many sequenced genomes
Fig. 26-21 EUKARYA Dinoflagellates Land plants Forams Green algae Ciliates Diatoms Red algae Amoebas Cellular slime molds Euglena Trypanosomes Animals Leishmania Fungi Sulfolobus Green nonsulfur bacteria Thermophiles (Mitochondrion) Spirochetes Chlamydia Halophiles COMMON ANCESTOR OF ALL LIFE Green sulfur bacteria BACTERIA Methanobacterium Cyanobacteria (Plastids, including chloroplasts) ARCHAEA
3 DOMAINS • Bacteria: contains most prokaryotes (“normal” bacteria) • Archaea: prokaryotes that live in “extreme” environments • Eukarya: contains all eukaryotes…Protists, Fungi, Plants, & Animals
Is the Tree of Life Really a Ring? • Some researchers suggest that eukaryotes arose as an endosymbiosis between a bacterium and archaean • If so, early evolutionary relationships might be better depicted by a ring of life instead of a tree of life