peyton
Uploaded by
59 SLIDES
843 VIEWS
600LIKES

Identifying human disease genes

DESCRIPTION

Identifying human disease genes. Overview Position independent methods Positional cloning Synteny Drosophila mutants that are positional candidates for human disease genes. Identifying human disease genes. Overview of the process. Identifying human disease genes.

1 / 59

Download Presentation

Identifying human disease genes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Identifying human disease genes • Overview • Position independent methods • Positional cloning • Synteny • Drosophila mutants that are positional candidates for human disease genes

  2. Identifying human disease genes • Overview of the process

  3. Identifying human disease genes • Position independent methods • Complementation

  4. 14_13.jpg

  5. Identifying human disease genes • Position dependent methods • CF gene chromosome jumping and walking

  6. Identifying human disease genes • Mouse and human synteny

  7. Identifying human disease genes • Drosophila and human disorders

  8. Genetic testing • Overview • Examples CF gene

  9. Genetic testing • CF testing • ARMs • OLA • Sequencing • Heteroduplex screening • DGGE • Mismatch cleavage

  10. Genetic testing • Oligonucleotide arrays

  11. 18_09_3.jpg

  12. Genetic testing • Forensics • Species identification • Paternity testing • DNA quantitation • Human identification

  13. Complex Biomaterials? Presence of human DNA? No Yes Exclusively human? If not human, What? Yes No Mixed species? Single contributor? No Yes DNA quantitation

  14. Non human DNA quantitation using intra-SINE PCR

  15. 100 bp DNA ladder Negative control Cow Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human 100 bp DNA ladder Negative control Cow Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human 100 bp DNA ladder Negative control Cow Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human A E I Avian Equine Mouse B F J Waterfowl Hamster Canine C G Guinea Pig Feline D H Rat Rabbit

  16. Our Assay Design Objectives • Human Specific a. Comparison of genomic sequences b. Testing complex biomaterials 2. Target Specific a. Comparison of target sequences b. Testing for non-specific amplification 3. Multiplex Compatible a. ABI Prism 7000 default PCR conditions b. Experimentally optimized PCR reagents FAM VIC NED

  17. Nuclear DNA

  18. Schematic of inter-Alu and intra-Alu PCR Inter-Alu PCR 5’ Alu 3’ 3’ Alu 5’ 5’ Alu 3’ 5’ Alu 3’ tail to tail head to head tail to head Intra-Alu PCR 5’ Alu Element 3’

  19. AluY GGCCGGGCGCGGTGGCTCACGCCTGT AATCCCAGCACTTTGGGAGGC CGA 50 AluYb8 ........................... ....................... 50 AluY GGCGGGCGGATCACGAGGT CAG GAGATCGAGACCATCCTGGCTAACACGG 100 AluYb8 ......T......T ............ .....................A.. 100 AluY TGAAA CCCCGTCTCTACTAAAAATAC AAAAAATTAGCCGGGCGTGGTGGC 150 AluYb8 .......................... .................C...... 150 AluY GGGCGCCTGTAGTCCCAGCTACTCGG GAGGCTGAGGCAGGAGAATGGCGT 200 AluYb8 ......................................... ......... 200 AluY CTTGCAGTGAGCCGAGAT GAACCCGGGAGGCGGAG CGCGCC ACTGCA C TC 250 AluYb8 T ..........A............... ......... ........... G .. 250 AluY GACAGAGCGAGACTCCGTCTC C A ------- GCCT GGGC AAAAAA 287 AluYb8 . GCAGTCCG ............................. ......294 Nuclear DNA target design Intra-Alu Yb8 PCR primers TaqMan-MGB probe

  20. Serial dilution of human nuclear DNA 100 ng 10 ng 1 ng 0.1 ng 0.01ng 1 pg

  21. 14 16 nDNA 18 y = -1.4761Ln(x) + 21.236 2 R = 0.9998 20 22 Threshold PCR cycle 24 26 28 30 32 34 100 10 1 0.1 0.01 0.001 DNA (ng) Nuclear DNA linear quantitation range VIC

  22. Mitochondrial DNA

  23. Mitochondrial DNA assay PCR primers TaqMan-MGB probe Incorporates specific diagnostic bases at the 3’ ends of each primer

  24. 14 16 18 20 22 Threshold PCR cycle 24 mtDNA 26 y = -1.4769Ln(x) + 22.547 2 R = 0.9999 28 30 32 34 100 10 1 0.1 0.01 0.001 DNA (ng) Mitochondrial DNAlinear quantitation range FAM

  25. Y chromosome DNA

  26. Human Y-chromosome DNA assay design Human X-chromosome 90 bp deletion in the X-Y homologous region PCR primers TaqMan-MGB probe

  27. Population Males Females Total 291 African-American 150 141 109 European-American 49 60 16 Hispanic-American 9 7 129 North-American 75 54 19 South-American 7 12 29 Asian 15 14 Total 305 288 593 Human Y chromosome locus fixation

  28. 27 29 31 Threshold PCR cycle 33 Male Y y = -1.4935Ln(x) + 34.74 35 2 R = 0.9994 37 39 100 10 1 0.1 DNA (ng) Male Y DNA linear quantitation range NED

  29. Multiplex Analysis

  30. Multiplex Analysis • Amplicon compatibility a. Test assays and modify amplicons 2. Human specificity a. Analyze mixed DNA samples 3. Background amplification a. Analyze DNA from nearest neighbors

  31. Contents Human male Dog Cat Total template Mix DNA (ng) % DNA (ng) % DNA (ng) % DNA (ng) % 1 50 50 25 25 25 25 100 100 2 5 50 2.5 25 2.5 25 10 100 3 0.5 5 5 50 4.5 45 10 100 4 0.05 0.5 5 50 4.95 49.5 10 100 5 0.005 0.05 5 50 4.995 49.95 10 100 “DNA mixtures” to test human specificity

  32. 14 16 nDNA 18 y = -1.4761Ln(x) + 21.236 2 R = 0.9998 20 22 24 Threshold PCR cycle mtDNA 26 y = -1.4769Ln(x) + 22.547 2 R = 0.9999 28 30 32 34 100 10 1 0.1 0.01 0.001 DNA (ng) Linear quantitative range of nDNA / mtDNA duplex The open symbols along each standard curve represent detection of human DNA within a mixed sample. nDNA VIC mtDNA FAM

  33. 18 20 nDNA 22 mtDNA 24 Threshold PCR cycle 26 28 30 32 34 rat cat pig dog cow deer NTC rabbit horse mouse sheep Gorilla chicken Bonobo Human nuclear Common chimp Human genomic DNA Source Duplex background amplification

  34. 18 20 nDNA y = -2.1185Ln(x) + 29.336 22 2 R = 1 24 mtDNA 26 y = -1.8375Ln(x) + 30.479 2 28 R = 0.9974 Threshold PCR cycle 30 32 34 36 Male Y y = -1.3824Ln(x) + 35.492 38 2 R = 0.9958 40 100 10 1 0.1 0.01 DNA (ng) Linear quantitative range of a nDNA / mtDNA / maletriplex PCR assay The open symbols along each standard curve represent accurate detection of human DNA within a mixed sample. VIC FAM NED

More Related