slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Today… PowerPoint Presentation
Download Presentation
Today…

Loading in 2 Seconds...

play fullscreen
1 / 46

Today… - PowerPoint PPT Presentation


  • 96 Views
  • Uploaded on

Genome 351, 7 April 2014, Lecture 3. Today…. The information in DNA is converted to protein through an RNA intermediate (transcription) The information in the RNA intermediate is converted into protein (translation) DNA & RNA use a triplet code for amino acids

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Today…' - ophira


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Genome 351, 7April 2014, Lecture 3

Today…

  • The information in DNA is converted to protein through an RNA intermediate (transcription)
  • The information in the RNA intermediate is converted into protein (translation)
  • DNA & RNA use a triplet code for amino acids
  • A gene is a segment of DNA that specifies a protein
  • Promoters: start sites of transcription
slide2

A

T

C

G

How does info in DNA flow to protein?

The genetic material: DNA

-Four subunits (bases A, C, G, T)

But virtually all cellular functions are mediated by proteins

-Twenty subunits (amino acids)

How does this work?

the rna tie club
The RNA Tie Club

-Proposed that a transient ribonucleic acid (RNA) intermediate is involved in the conversion of info from DNA to protein

slide4

The “Central Dogma”

messenger RNA (mRNA)

deoxyribose sugar in DNA

sugar-phosphate backbone

ribose sugar in RNA

RNA Bases includeA,C,G,U

5’

DNA Bases includeA,C,G,T

???

translation

transcription

DNA is double-stranded

RNA is (mostly) single-stranded

(G:C & A:U)

3’

RNA

DNA

Protein

slide5

DNA replication

(heredity)

phenotype

The “Central Dogma”

transcription

translation

DNA

mRNA

Protein

genotype

-Information only flows one way

-It’s universal (works the same way in prokaryotes & eukaryotes)

slide6

mRNA

promoter

mRNA

promoter

terminator

Transcription: copy gene into mRNA to make a specific protein

Mendel’s units of information (genes) are particular sequences along the chromosomes.

gene

gene

gene

where trans-cription ends

where transcription begins (more later)

This region from chromsome 7 contains the CFTR (cystic fibrosis gene):

CFTR

CORTBP2

GASZ

116.9

117.1

117.3

116.7

position in human sequence (millions of bases)

slide7

mRNA

promoter

mRNA

promoter

terminator

Transcription: copy gene into mRNA to make a specific protein

Mendel’s units of information (genes) are particular sequences along the chromosomes.

gene

gene

gene

where trans-cription ends

where transcription begins (more later)

This region from chromsome 7 contains the CFTR (cystic fibrosis gene):

CFTR

CORTBP2

GASZ

116.9

117.1

117.3

116.7

position in human sequence (millions of bases)

slide8

mRNA

promoter

mRNA

Transcription: copy gene into mRNA to make a specific protein

gene

promoter

gene

gene

A G C

5’

3’

3’

5’

T C G

A

G

C

5’

3’

3’

5’

G

C

T

RNA polymerase

slide9

mRNA

promoter

mRNA

Transcription: copy gene into mRNA to make a specific protein

gene

gene

gene

promoter

A G C

5’

3’

3’

5’

T C G

A

G

C

5’

3’

C

G

A

3’

5’

G

C

T

slide10

Transcription: copy gene into mRNA to make a specific protein

coding or sense strand

(same sequence as mRNA)

T

A

C

5’

3’

C

3’

A

U

3’

5’

G

T

A

mRNA

template strand (complementary to mRNA)

5’

Where’s the 5’ end of the gene? of the mRNA?

Which way is RNA polymerase moving?

slide11

Transcription: copy gene into mRNA to make a specific protein

I. initiation

II. elongation

III. termination

slide12

DNA

nascent RNA transcripts

RNA polymerases

Transcription in vivo

Where (right or left) is the promoter?

gene

Which strand (top or bottom) is the template?

Which way (right or left) are RNA polymerases moving?

slide13

DNA

nascent RNA transcripts

RNA polymerases

Transcription in vivo

Where (right or left) is the promoter?

gene

Which strand (top or bottom) is the template?

Which way (right or left) are RNA polymerases moving?

5’

3’

3’

5’

3’

5’

5’

3’

slide14

RNA carries the information from DNA in the nucleus to the cytoplasm

Transcription

DNA

RNA

Translation

Protein

the morse code
The Morse Code

Morse code key

Letters:

Numbers:

… --- …

= SOS

A lot of information can be relayed using just a 3 bit code: dots, dashes and spaces

slide17

How is information coded in DNA?

Translating the nucleic acid code (4 different bases) to a protein code (20 aa’s)…

Possible coding systems:

1 base per amino acid

Could only code for 4 amino acids!

2 bases per amino acid

Could only code for 16 amino acids

3 bases per amino acid

64 possible combinations… that’s plenty!

20 different amino acids and 64 possible combinations of three bases 64 codons
20 different amino acids and 64 possible combinations of three bases (64 “codons”)

Alanine

Arginine

Aspartic acid

Aspargine

Cysteine

Glutamic acid

Glutamine

Glycine

Histidine

Isoleucine

Leucine

Lysine

Methionine

Phenylalanine

Proline

Serine

Threonine

Tryptophan

Tyrosine

Valine

Stop

Ala

Arg

Asp

Asn

Cys

GlT

Gln

Gly

His

Ile

LeT

Lys

Met

Phe

Pro

Ser

Thr

Trp

Tyr

Val

A

R

D

N

C

E

Q

G

H

I

L

K

M

F

P

S

T

W

Y

V

*

GCA, GCC, GCG, GCT

AGA, AGG, CGA, CGC, CGG, CGT

AAC, AAT

GAC, GAT

TGC, TGT

GAA, GAG

CAA, CAG

GGA, GGC, GGG, GGT

CAC, CAT

ATA, ATG, ATT

TTA, TTG,CTA, CTC, CTG, CTT

AAA, AAG

ATG

TTC, TTT

CCA, CCC, CCG, CCT

AGC, AGT, TCA, TCC, TCG, TCT

ACA,ACC, ACG, ACT

TGG

TAC, TAT

GTA, GTC, GTG, GTT

TAA, TAG, TGA

There is redundancy (more than one codon) for some amino acids, but each codon specifies only one amino acid

slide21

codon

A

U

mRNA

G

A

C

5’

3’

U

U

A

U

A

A

C

A

G

A

C

U

C

U

C

A

M

e

t

T

h

r

S

e

r

V

a

l

T

h

r

P

h

e

NH3+

COO-

Translation: converting the nucleic acid code to protein

The triplet code

3 bases = 1 amino acid

More than 1 triplet can code for the same amino acid

Translation: read the information in RNA to order the amino acids in a protein

protein

slide22

start:

AUG = methionine, the first amino acid in (almost) all proteins

stop:

UAA, UAG, and UGA.

A

U

mRNA

G

A

C

5’

3’

U

U

A

U

A

A

C

A

G

A

C

U

C

U

C

A

STOP

M

e

t

T

h

r

S

e

r

V

a

l

T

h

r

P

h

e

NH3+

COO-

Translation: converting the nucleic acid code to protein

Punctuation:

protein

translation of the mrna requires an rna adaptor called transfer rna trna
Translation of the mRNA requires an RNA adaptor called transfer RNA (tRNA)

pairs with the codon in mRNA

Each codon has a specific tRNA with a complementary anticodon, linked to a specific amino acid.

slide24

Met

Met

anticodon

UAC

UAC

Recognizes AUG codon in mRNA

5’ AUG 3’

tRNAs ferry amino acids to the mRNA during translation

amino acid

3’

“charged” tRNA

transfer RNA

(tRNA)

aminoacyl-tRNA

synthetase

slide25

The ribosome: mediates translation

  • A large complex of ribosomal RNAs (rRNAs) & proteins make up a ribosome
  • Two subunits that join during protein synthesis
  • rRNAs Provide structural support and serve as catalysts (ribozymes)

5,080 bases of rRNA (2-3 different rRNAs)

~49 proteins

1,900 base rRNA

~33 proteins

slide26

Thr

Met

UAC

...

UGA

...

Translation

ribosome + met-tRNA locates the 1st AUG (from 5’ end) & sets the reading frame for codon-anticodon base-pairing

ribosome

mRNA

…AUAUGACUUCAGUAACCAUCUAACA…

5’

3’

After the 1st two tRNAs have bound…

slide27

Thr

Met

UAC

UGA

...

Translation

the ribosome breaks the Met-tRNA bond; Met is joined to the second amino acid…

ribosome

mRNA

...

…AUAUGACUUCAGUAACCAUCUAACA…

5’

3’

slide28

Thr

Met

UAC

UGA

...

Translation

the ribosome breaks the Met-tRNA bond; Met is joined to the second amino acid… the Met-tRNA is released

ribosome

mRNA

…AUAUGACUUCAGUAACCAUCUAACA…

5’

3’

…then ribosome moves over by 1 codon in the 3’ direction

slide29

Thr

Ser

Met

AGU

...

UGA

...

Translation

and the next tRNA can bind, and the process repeats

mRNA

…AUAUGACUUCAGUAACCAUCUAACA…

5’

3’

slide30

Ser

Met

AGU

...

Translation

Thr

UGA

mRNA

…AUAUGACUUCAGUAACCAUCUAACA…

5’

3’

slide31

Ser

Met

AGU

...

Translation

Thr

mRNA

…AUAUGACUUCAGUAACCAUCUAACA…

5’

3’

slide32

Met

Thr

Ser

Val

Thr

Phe

UAG

...

STOP

Translation

When the ribosome reaches the Stop codon… termination

…AUAUGACUUCAGUAACCAUCUAACA…

5’

3’

slide33

Met

Thr

Ser

Val

Thr

Phe

The finished peptide!

NH3+

COO-

Peptide = short protein

Polypeptide = longer protein

…AUAUGACUUCAGUAACCAUCUAACA…

5’

3’

slide34

Transcription and translation occur in separate compartments in eukaryotes…

Transcription

Translation

slide35

DNA

…but bacteria lack a nucleus

transcription and translation take place in the same compartment

mRNAs covered with ribosomes

slide36

3’

5’

3’

5’

Questions

DNA

mRNA

ribosome

A

B

Where are the 5’ and 3’ ends of the mRNA?

slide37

Questions

Which strand on the DNA sequence is the coding (sense) strand? How can you tell?

upper strand

slide38

Questions

On the DNA sequence, circle the nucleotides that correspond to the start codon.

slide39

Questions

How many amino acids are encoded by this gene?

13

slide40

Questions

Do you expect the start and stop codons of gene 2 to be represented in the DNA sequence that is shown?

the form of mrna
The form of mRNA

Translation start

Translation stop

Non-coding

Coding sequence that gets translated into protein

Non-coding

5’

3’

An mRNA starts out with non-coding sequence at the beginning, followed by a start codon, the coding sequence, a stop codon and more non-coding sequence

The non-coding portion is often referred to as the ‘untranslated region’ or UTR.

rna is sometimes the active product of a gene
RNA is sometimes the active product of a gene!
  • tRNA -- transfer RNA
  • ribosomal RNA (rRNA) -- the translation apparatus)
  • small nuclear RNAs (snRNA) -- part of the machinery that helps splice the mRNA (more later on this)
  • microRNAs (miRNA) -- regulate mRNA translation
slide43

Regulation of mRNA translation

Animal and plant cells have two mechanisms to regulate mRNA translation.

Both mechanisms involve recognizing double stranded RNA.

In the first, cells transcribe short RNAs (microRNAs; miRNA) that can bind imperfectly to the UTR of mRNAs and inhibit translation.

In the second, cells recognize double-stranded RNA (dsRNA) and degrade it to small fragments. These small fragments (small interfering RNA; siRNA) are then incorporated into a complex that binds to the matching mRNA and destroys it!

slide44

miRNA that bind imperfectly can regulate mRNA translation

Pre-miRNA

Processing

Binds to target mRNA

mRNA

Inhibits translation

slide45

miRNA that bind perfectly can destroy mRNA

dsRNA

processing (Dicer)

siRNA

cleavage (Ago)

bind to mRNA

cleavage (RISC)

mRNA

slide46

siRNA

siRNA (small interfering) may able to be used therapeutically to silence specific genes

RISC

mRNA