slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
T-DNA mapping by PCR PowerPoint Presentation
Download Presentation
T-DNA mapping by PCR

Loading in 2 Seconds...

play fullscreen
1 / 6
oihane

T-DNA mapping by PCR - PowerPoint PPT Presentation

120 Views
Download Presentation
T-DNA mapping by PCR
An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. ABE workshop 2007 T-DNA mapping by PCR Eun Ju Cho

  2. Objectives To more fully understand the function of PDIs in plants, we are using a method called “gene knockouts”, which allows the determination of the resulting effects of the absence of a specific gene on growth, development, cell physiology and biochemistry. The gene is knocked out by disruption with a DNA insertion that contains a kanamycin resistance gene (kanR), called a “T-DNA”.

  3. What is the T-DNA? “Transfer”-DNA (T-DNA) can be randomly inserted into the plant genome by Agrobacterium tumefaciens. The T-DNA contains a selectable marker (kanamycin resistance) and other genes for growth of the Agrobacterium. The insertion of T-DNA into a gene disrupts the gene (“knockout”) and the function of the protein it encodes.

  4. Genetic Map of T-DNA knockout mutant of PDI2 ~200bp LB1 T-DNA ~300bp UTR Exon 1 E2 UTR RP LP ATG 890bp Chromosome 1 At1g52260(PDI 3) LP - Left genomic primer (CCAAAATTAAAAACCAAAAAGCAA) RP - Right genomic primer (TCAAGAAATCTCGGAGCTTCA) LB1 - Left border primer of the T-DNA insertion: ( GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC)

  5. T-DNA sequence of PDI3 SAIL_302_G10(1071bp) aaatcgaattaattcggcgtaattacgacattaaaaacgtccgcaaggtgttatataagt tgtctaagcgtcaatttgtgataggaattcgaagattgcatcggagcttgagatataaag gtttccctacgcttcttctctactgctcctacacaannnnnnggagccannntccgacgg acggaacagaggcaccagaggccaacacactgaaaagatcattggctgaatacacaaccg aaggtgaagagagagccacaaggaaaacacaaaaacccccaggactaagcgcccgctcaa tccactccaaaaaacacgaccgaataaagcgcactgataaaacacactgaacaacccaaa accacgaagttgcatcatcgaacggctggcagagaaaaagaaccattagacaaacaacgc gcggacatggaacccagacacatacccaacgagaacgcatacgcctacaaatcgcggggt cccaacaaaaaacagcacccgcgccccacaccacacaccgcagtgaagagaacaacacga aacaagaaaaccccgaagagagcgccccccaccccgcacgtgaggaccagccgagacgaa ccagggcggggcacagagagaacacaagggggaacgagagggggcacgcacagagcagga gccaaacgggccagcccaaccccaccaccgcccccacacaacgacgcccaccccacccga cgacccacccccaccgcgcccaacccaccgcaaccccaccccccccgccacccccactcc ccgcggcgcccaccaccacgccccacgcccacacgccaccgcacgacccaanaacacccc gcccgccccacccgccacgaaccgcacccaccgcgccccccaccaccaccccccgccccc cccgccgacgcccgccaccaccacacacgcaccccccaaacccccccaccaccaccccac gcccgcgcgcacccccccccnncccanaacccgccgccccccccccccaacacccgcccc cgccacccccgcgcccgcccgccgcnaccccccacccccaccccaccaccn

  6. PCR mapping for T-DNA knockout mutant of PDI 3 M HM HZ WT T- DNA Primer design LP + RP + LB1 WT : no insertion (890bp) HM : insertion both chromosome (~500bp) HZ : one of the pair chromosome with insertion 1kbp 517bp Condition 94℃ 5min 94 ℃ 30sec 55 ℃ 30sec 30 cycle 72 ℃ 1min 72 ℃ 10min