120
36. 34. 32. 30. Temperature (°C). 28. 26. 24. 22. 20. 0. 120. 240. 360. 480. 600. 720. 840. 960. 1080. Time (s). Supplementary Figure 1.
120
E N D
Presentation Transcript
36 34 32 30 Temperature (°C) 28 26 24 22 20 0 120 240 360 480 600 720 840 960 1080 Time (s) Supplementary Figure 1 Graph of temperatures measured over time in seven different temperature zones during a test run. The power supply was switched off after approximately 1000 s. The set values were 22, 25, 28, 31, 34, 37, and 40 °C.
Supplementary Figure 2 Melting curve analysis using the MTAW. TC-p26-W and TC-p26-M capture sequences were spotted on agarose-coated slides as eight subarrays, each fitting into one chamber in the MTAW. The entire array was hybridized with saturating amounts of Cy3-labeled target (W54-T-W, and the slide was mounted in the MTAW device and the subarrays were subjected to washing in different zones with temperatures ranging from 25 to 60 °C at increments of 5 °C. The slide was subsequently washed at low stringency, dried, and scanned. 1.2 TC-p26-W - 1 TC-p26-M 0.8 Normalized florescence 0.6 Tm=39 ° C Tm=37 ° C 0.4 0.2 0 25 30 35 40 45 50 55 60 Temperature, ° C TC-p26-W: TTTTTTTTTTCCCCCCCCCCGCCACGCTCATCGACAAGCTTGTC TC-p26-M: TTTTTTTTTTCCCCCCCCC············T············ W54-T-W : 5’-Cy3-GATGACTTCGCAGAGACAAGCTTGTCGATGAGCGTGGCAGCATCTTCAACTGTCGCAATT -3’
Supplementary Figure 3 MT signal WT signal Melting curves of the wild-type (square) and the mutant (diamond) probe in each probe pair tested. The graphs are based on quantified signal intensity (in arbitrary units, a.u.) of the results shown in the scanning images in Figure 2 (A and B) for the corresponding temperatures. The secondary Y-axes (triangles) show the normalized ratios (see Materials and Methods) calculated from the signals of the wild-type and mutant probes at the indicated temperatures. Ratio 8000 1 4000 1 6000 0.75 3000 0.75 4000 0.5 2000 0.5 CD8 CD5 2000 0.25 1000 0.25 0 0 0 0 22 25 28 31 34 37 40 22 25 28 31 34 37 40 8000 1 8000 1 6000 0.75 6000 0.75 4000 0.5 4000 0.5 CD15 2000 0.25 2000 0.25 CD8/9 0 0 0 0 22 25 28 31 34 37 40 22 25 28 31 34 37 40 8000 1 8000 1 6000 0.75 6000 0.75 4000 0.5 4000 0.5 Normalized Ratio Signal intensity (a.u.) 2000 0.25 2000 0.25 CD24 CD17 0 0 0 0 22 25 28 31 34 37 40 22 25 28 31 34 37 40 8000 1 8000 1 6000 0.75 6000 0.75 4000 0.5 4000 0.5 2000 0.25 2000 0.25 CD27/28 IVS I+5 0 0 0 0 22 25 28 31 34 37 40 22 25 28 31 34 37 40 8000 1 8000 1 6000 0.75 6000 0.75 CD24 (13/13) 4000 0.5 4000 0.5 2000 0.25 2000 0.25 IVS I+6 0 0 0 0 22 25 28 31 34 37 40 22 25 28 31 34 37 40 8000 1 8000 1 6000 0.75 6000 0.75 4000 0.5 4000 0.5 CD27/28 (12/12) 2000 0.25 2000 0.25 CD27/28 (13/13) 0 0 0 0 22 25 28 31 34 37 40 22 25 28 31 34 37 40 8000 1 Temperature (ºC) 6000 0.75 4000 0.5 2000 0.25 CD27/28 (12/13) 0 0 22 25 28 31 34 37 40 Temperature (ºC)
Supplementary Figure 4 Summary of melting temperature (Tm) versus temperature for best classification (Tc).Tc values from data presented in Figures 3 and 4, and summarized in Figure 5. Calculated Tm values for the wild-type probe in each probe pair are from Table 1. Observed Tm is the temperature at which a half maximum signal was observed (Supplementary Figure 3). 70 60 50 Calculated Tm 40 Temperature (degree C) Tc 30 Observed Tm 20 10 0 CD5 CD8 CD15 CD17 CD24 CD8/9 CD24 IVS I +5 CD27/28 IVS I +6 CD27/28 CD27/28 13 13 12 Tm set nt nt nt