1 / 24

Advances in Osteoarthritis Research Tools: Unleashing Potential for Tackling Joint Health

Explore the latest tools and methods in osteoarthritis research, from Meniscus and Tissue Histology to Molecular Biology and Western Blotting. Discover how advancements in RT-PCR and ELISA are revolutionizing the study of gene expression and protein quantification.

nishan
Download Presentation

Advances in Osteoarthritis Research Tools: Unleashing Potential for Tackling Joint Health

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. TACKLING OSTEOARTHRITIS-Research Tools At Our Disposal Mahita Kadmiel July 21, 2005

  2. OSTEOARTHRITIS • Arthritis -most common medical problem • No. 1 cause of disability in America. • arthron = joint itis = inflammation. arthritis = joint inflammation. • osteoarthritis, is the most common form of arthritis • affects nearly 21 million people in the United States

  3. MENISCUSThe Meniscus: Shock Absorber for the Knee Meniscal Tears • Traumatic tears From a sudden load being applied to the meniscal tissue which is severe enough to cause the meniscal cartilage to fail and let go. Ex. Twisting injury • Degenerative meniscal tears Failure of the meniscus over time. The meniscus becomes less elastic and compliant May fail with only minimal trauma Ex. Just getting down into a squat *Degenerative meniscal tears can lead to osteoarthritis*

  4. Healthy meniscus Torn meniscus

  5. The expression of genetic material in the meniscus dictates it

  6. Central Dogma of Life Reverse Transcription

  7. Proteins make a cell what it is

  8. Staining to find -how the cells look (anatomy) (TARA) • Staining to find • if cells are dead or alive (viability) • (TUMUL) TISSUE Histology CELLS Cell Biology TOOLS Proteins Molecular Biology Biochemistry Western Blotting -To detect proteins ELISA -To quantify proteins Enzyme Assays -To measure enzyme activity DNA Southern Blotting -To find copy number of genes Genome Sequencing Northern Blotting RT-PCR Real-Time PCR -To study gene expression RNA (TUMUL, BASIA & MYSELF)

  9. Tools used in our lab RT-PCR Real-Time PCR -To study gene expression ELISA -To quantify proteins

  10. Preparation of cDNA or first strand RT Reverse Transcription 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ mRNA 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ Reverse transcriptase ……TTTTTTT 5’ A, T, G, C dNTPs Reverse Transcription 3’ CTGGGTTAACCAGTCGATTTTTTT 5’ 1ST strand cDNA (complementary DNA)

  11. PCR : Polymerase Chain Reaction

  12. Reverse Transcriptase- Polymerase Chain Reaction -Exponential amplification End of 35 cycles 236 = millions of copies PCR products RT Marker RNA 22 23 24 32 copies 8 copies 4 copies 16 copies

  13. Real-Time PCR SYBR Green Dye PCR products Single stranded DNA Double stranded PCR product SYBR Green fluoresces brightly only when bound to double stranded DNA Ethidium Bromide

  14. Real-Time PCR • Quantitative method • Most reliable for mRNA (gene) expression • Small amounts of RNA required / tissue • Amplification monitored by fluorescence in real-time 96 well plate

  15. Theoretical and Ideal Practical !!!!!

  16. SERIES OF 10-FOLD DILUTIONS • Standard curve generated using serial dilution

  17. Melting / Dissociation Curve primer dimer

  18. E Enzyme Protein molecule that performs a chemical reaction L Linked Linking an enzyme to an assay/test Attachment of antibodies I Immuno S Sorbent Test to find out something A Assay • Technique based on antigen-antibody reaction • Examples: HIV tests &PGE2

  19. Well with antibodies and BSA added Well with antibodies Well with antibodies, BSA, and test sample Well in a microtiter plate Antibody structure Well after washes with wash buffer ELISA Well after adding substrate Color developed due to the formation of a substrate Secondary antibody linked to an enzynme is added to the well Well after removing excess antibody

  20. Other Techniques • Genome Sequencing • To find out • the base composition (A, T, G, C) • The order in which the bases are arranged • Northern Blotting ( mRNA expression) • Southern Blotting (copy number) • Western Blotting ( protein expression)

  21. Southern / Northern Blotting

  22. Western Blotting

  23. IL-1 iNOS COX-2 MMP IL-1 TNF RT-PCR PGE2 iNOS iNOS ELISA Colorimetric Assays GAG Nitrate & Nitrite NO MMP COX-2 PGE2 (GAG) Degrades tissue Inflammatory mediators

  24. Questions???????

More Related