neo
Uploaded by
24 SLIDES
587 VIEWS
250LIKES

Transcription

DESCRIPTION

Transcription. Bellwork Obj : Simulate the process of transcription HW: Finish Transcription problems. What is the “central dogma or big idea” of biology? What are the 3 kinds of RNA? Describe the function of each type of RNA

1 / 24

Download Presentation

Transcription

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Transcription

  2. BellworkObj: Simulate the process of transcriptionHW: Finish Transcription problems What is the “central dogma or big idea” of biology? What are the 3 kinds of RNA? Describe the function of each type of RNA Give at least 2 reasons why making proteins is such an important process When you are finished, write down as many things as you can remember about the similarities & differences between DNA & RNA

  3. VIDEO CLIP: chefs • http://www.youtube.com/watch?v=H5udFjWDM3E

  4. So how does RNA make proteins??? DNA stores information to run cell DNA RNA’s function is to make proteins! RNA Proteins actually DO the work in the cell Protein

  5. Protein Synthesis • To get from a DNA gene to a protein, the cell has to perform protein synthesis. • It requires 3 types of RNA: • mRNA • rRNA • tRNA • It happens in 2 parts: • Transcription • Translation

  6. Transcription Transcription is the process of making an mRNA copy of the DNA instructions (recipe for a protein). Occurs in the nucleus.

  7. Transcription video clip • http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html

  8. Transcription- Step1 Signal Transcription begins when the cell receives a message to make a certain quantity of a specific protein.

  9. Example • After drinking milk, your cells receive a signal to begin making more LACTASE- the enzyme that breaks down lactose (milk sugar) What other example can you think of that would signal cells to make a protein?

  10. Transcription- Step 2 Unzipping RNA Polymerase “unzips” the DNA so it can get to the gene (recipe for the protein) on a single strand

  11. What kind of molecule is RNA polymerase (hint- look at the ending of the word)?

  12. Transcription- Step 3 Binding & Reading RNA polymerase binds to the promoter or starter DNA sequence (usually “TATA”) and begins making the complementary mRNA copy

  13. Practice • Try #1 on your transcription worksheet G C C T G A C A C G T C A T C CC G A G T A AA _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ • #2- Circle promoter (TATA) • GACCTATAGTCTAG CTATAATGCTACACTGAGCTGCG • CAGGATATCAGATC GATATTACGATGTGACTCGACGC • GTCGAACGTATACGGGTGCATGATCCT GTATCGATCGAAATATCGATCGTTA • CAGCTTGCATATGCCCACGTACTAGGA CATAGCTAGCTTTATAGCTAGCAAT • #3- Underline the sequence that will be copied into mRNA C G G A C U G U G C A G U A G GG C U C A U UU

  14. Practice Circle the promoter, underline the sequence to be made into mRNA, make the complementary mRNA underneath • T G C A T A T G GG A T G T G C T G A T C G A T T G A G T G A • A C G T A T A C CC T A C A C G A C T A G C T A A C T C A C T mRNA: G GG A U G U G C U G A U C G A U U G A G U G A

  15. Transcription- Step 4 DNA closes After gene is transcribed, DNA zips back up (closes)

  16. Take your Handout • Fold it correctly to reveal the hidden picture!

  17. Transcription- Step 5 mRNA Splicing mRNA is spliced • Segments called introns are removed (not part of the recipe) • Segments called exons are kept (final recipe)

  18. Talk to your neighbor • How did the Harry Potter fold-in model the process of mRNA splicing? Explain intronsvsexons.

  19. Bellwork Explain the analogy of the cake making. What is the Recipe book? What is the copy of the recipe? What is the recipe? What is the ‘name’ of the recipe that alerts you to it’s presence What is the cook who ‘reads’ the recipe? What are the ingredients called?

  20. Practice Circle the promoter, underline the sequence to be made into mRNA, make the complementary mRNA underneath • T G C A T A T G GG A T G T G C T G A T C G A T T G A G T G A • A C G T A T A C CC T A C A C G A C T A G C T A A C T C A C T mRNA: G GG A U G U G C T G A U C G A U U G A G U G A Boxed-in parts = introns Remove introns: G GG A U G U G C T G A A U UU G A Mature mRNA: G GG A U G U G C T G A A U UU G A

  21. Transcription- Step 6 mRNA leaves nucleus The mature mRNA leaves the nucleus to find a ribosome

  22. Transcription summary- Summarize transcription to your neighbor

  23. Transcription Activity • You and your partner will receive a “signal” in the cytoplasm (lab table) to begin transcription of a specific protein • Go into the nucleus (desk-side) & find the appropriate gene on the DNA molecule to transcribe mRNA from • Record the mRNA on your worksheet • Splice the mRNA according to instructions • Take your mature mRNA out of the nucleus & into the cytoplasm to (double check it with the answer key at your lab table) • Move to the next lab table to get a new signal & repeat **If you finish early, begin the HW problems

  24. Closure Write a note to a student who was absent explaining what they need to know about transcription. **If you finish early, begin the HW problems

More Related