ayame
Uploaded by
70 SLIDES
978 VIEWS
720LIKES

Transcription

DESCRIPTION

Transcription. Bellwork - 3 minutes! (work quickly). Draw a picture of each of the 3 kinds of RNA Describe the function of each type of RNA Give at least 2 reasons why making proteins is such an important process

1 / 70

Download Presentation

Transcription

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Transcription

  2. Bellwork- 3 minutes! (work quickly) Draw a picture of each of the 3 kinds of RNA Describe the function of each type of RNA Give at least 2 reasons why making proteins is such an important process When you are finished, write down as many things as you can remember about the similarities & differences between DNA & RNA

  3. So how does RNA make proteins??? DNA stores information to run cell DNA RNA’s function is to make proteins! RNA Proteins actually DO the work in the cell Protein

  4. Protein Synthesis • Protein synthesis is the process of making proteins. • It happens in 2 parts: • Transcription • Translation

  5. Fill in the table for transcription Transcription is the process of making an mRNA copy of the DNA instructions (recipe for a protein). Occurs in the nucleus.

  6. Transcription video clip • http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html (1:52)

  7. Step1: Signal The cell receives a signal to make a specific protein.

  8. Example • After drinking milk, your cells receive a signal to begin making more LACTASE- the enzyme that breaks down lactose (milk sugar) What other example can you think of that would signal cells to make a protein?

  9. Step 2 : Promoter RNA polymerase binds to the promoter sequence on DNA (usually “TATA”).

  10. Practice • #1- Find & circle the promoter (TATA) in each gene • GACCTATAGTCTAG CTATAATGCTACACTGAGCTGCG • CAGGATATCAGATC GATATTACGATGTGACTCGACGC • GTCGAACGTATACGGGTGCATGATCCT GTATCGATCGAAATATCGATCGTTA • CAGCTTGCATATGCCCACGTACTAGGA CATAGCTAGCTTTATAGCTAGCAAT

  11. What kind of molecule is RNA polymerase (hint- look at the ending of the word)?

  12. Step 3: mRNA message RNA polymerase reads the DNA & makes an mRNA complement of the gene

  13. Practice • #1- Find & circle the promoter (TATA) in each gene • GACCTATAGTCTAG CTATAATGCTACACTGAGCTGCG • CAGGATATCAGATC GATATTACGATGTGACTCGACGC • GTCGAACGTATACGGGTGCATGATCCT GTATCGATCGAAATATCGATCGTTA • CAGCTTGCATATGCCCACGTACTAGGA CATAGCTAGCTTTATAGCTAGCAAT • #2- Underline the sequence that will be read by RNA Polymerase • Try #3 on your transcription worksheet G C C T G A C A C G T C A T C C C G A G T A A A _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ C G G A C U

  14. Practice- Put Steps 1-3 together #4 Circle the promoter, underline the sequence to be made into mRNA, make the complementary mRNA underneath • T G C A T A T G GG A T G T G C T G A T C G A T T G A G T G A • A C G T A T A C CC T A C A C G A C T A G C T A A C T C A C T mRNA: G GG A U G U G C T G A U C G A U U G A G U G A #5 Draw vertical lines on the mRNA strand above to show separate codons

  15. Step 4 : mRNA Splicing (cutting) • Segments called introns are removed (not part of the recipe) • Segments called exons are kept (final recipe)

  16. Take your Handout • Fold it correctly to reveal the hidden picture!

  17. Talk to your neighbor • How did the Harry Potter fold-in model the process of mRNA splicing? Explain intronsvsexons.

  18. Practice Circle the promoter, underline the sequence to be made into mRNA, make the complementary mRNA underneath • T G C A T A T G GG A T G T G C T G A T C G A T T G A G T G A • A C G T A T A C CC T A C A C G A C T A G C T A A C T C A C T mRNA: G GG A U G U G C T G A U C G A U U G A G U G A Boxed-in parts = introns Remove introns: G GG A U G U G C T G A A U UU G A Mature mRNA: G GG A U G U G C T G A A U UU G A

  19. Step 5 : mRNA leaves nucleus The mature mRNA moves out of the nucleus

  20. Transcription video clip- one more time • http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html

  21. Transcription summary- Summarize transcription to your neighbor

  22. Transcription Activity • You and your partner will receive a “signal” in the cytoplasm (lab table) to begin transcription of a specific protein • Go into the nucleus (desk-side) & find the appropriate gene on the DNA molecule to transcribe mRNA from • Record the mRNA on your worksheet • Splice the mRNA according to instructions • Take your mature mRNA out of the nucleus & into the cytoplasm to (double check it with the answer key at your lab table) • Move to the next lab table to get a new signal & repeat **Must finish transcribing at least 2 genes. Then you may begin the HW (on back of class practice sheet)

  23. Closure- on notetaker Write a note to a student who was absent explaining what they need to know about transcription. **If you finish early, begin the HW problems

  24. Bellwork- What part of the word “transcription” will help you remember that it is about making a message/mRNA? Give a snapshot of transcription by summarizing it in 20-25 words.

  25. Transcription Activity (20-30 mins) • You and your partner will receive a “signal” in the cytoplasm (lab table) to begin transcription of a specific protein • Go into the nucleus (desk-side) & find the appropriate gene on the DNA molecule to transcribe mRNA from • Record the mRNA on your worksheet • Splice the mRNA according to instructions • Take your mature mRNA out of the nucleus & into the cytoplasm to (double check it with the answer key at your lab table) • Move to the next lab table to get a new signal & repeat **Bio 1-2: Must transcribe at least 5 genes total. Ex. credit for each additional gene. **PreAP: Must transcribe all 8 genes

  26. PreAP – What to do until Quiz • Check HW with answer key (no late HW accepted) • Organize notebook & unit divider • Use RNA review sheet to prepare

  27. If you finish early…. Bio 1-2: 1. Start the back of the pink practice sheet (the HW side) – good practice for transcription quiz @ end of class today! 2. Review your transcription notes- quiz @ end of class PreAP: 1. Quiz your partner on the RNA Notetaker & Protein Synthesis Notetaker to review for transcription quiz

  28. Transcription video clip- one more timewith the sound OFF- narrate to your neighbor • http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html

  29. Closure- on notetaker Write a note to a student who was absent explaining what they need to know about transcription. **If you finish early, begin the HW problems (Bio 1-2)

  30. Translation

  31. Bellwork Look at your transcription simulation (blue) from yesterday…what 3 letter codon tends to appear near the beginning of every mature mRNA? Give a possible function of this codon based on its appearance near the beginning of mRNA strands. Summarize each of the 5 steps of transcription Make an mRNA copy from the DNA gene: GCATATGCAATGATAGATTGA CGTATACGTTACTATCTAACT How did you know whether the gene was on the top or bottom strand? Create a memorization strategy for how to remember the difference between introns & exons.

  32. Bellwork Summarize each of the 5 steps of transcription Make an mRNA copy from the DNA gene: GCATATGCAATGATAGATTGA CGTATACGTTACTATCTAACT 3. How did you know whether the gene was on the top or bottom strand? 4. Create a memorization strategy for how to remember the difference between introns & exons.

  33. What codon always shows up near the beginning? • Mature mRNA for lactase enzyme: • GCG AUG CUG GGU CGU UAA • Mature mRNA for Myosin protein: • AUG CGC CGU UUG UGA • Mature mRNA for hemoglobin A protein: • GGC AUG CGA UAC CUC UAA • Mature mRNA for ATP Synthase enzyme: • GAU CUG AUG CCU AAC UGC AUC

  34. Protein Synthesis • Protein synthesis is the process of making proteins. • It happens in 2 parts: • Transcription • Translation

  35. Fill in the table for Translation Translation is the process of making an amino acid chain from the instructions coded in the mRNA. Occurs in cytoplasm.

  36. Translation Video Clip • http://www.youtube.com/watch?v=41_Ne5mS2ls (start @ 1:56)

  37. step 1 : Initiation mRNA binds to the ribosome & the ribosome begins reading @ START codon (AUG)

  38. Practice GCG AUG CUG GGU CGU UAA Which codon above is the START codon? On your worksheet, find the START codon in each of the 8 mature mRNA strands

  39. step 2: tRNA matching The ribosome matches each codon with a tRNA that has the complementary anti-codon tRNA w. amino acid @ top (Met) & anticodon on bottom (UAC)

  40. Practice What is the anticodon on tRNA that will match with the START codon on mRNA? AUG CCG GCA UGC GGA CUG On your worksheet, fill out the tRNAanticodons for each codon in the mature mRNA strand

  41. step 3: Elongation Each tRNA that enters the ribosome adds an amino acid. A peptide (protein) bond attaches new amino acids to the growing chain.

  42. FYI • There are 20 amino acids • Each tRNA can only carry ONE type of amino acid tRNA w/ anticodon “UAC” can ONLY carry methionine (M)

  43. step 4: Termination When an mRNA STOP codon (UAA, UAG, or UGA) enters the ribosome, the ribosome subunits break apart and translation ends

  44. Practice STOP (no amino acid) How many amino acids are coded for in the mature mRNA strand below? (hint: think about start & stop codons) GAU CUG AUG CCU AAC UGC AUC UAG GCA On your worksheet circle the START codon, Box the STOP codon, and record how many amino acids will be in the chain after translating each of the 8 mRNA strands. Start: 1 2 3 4 5 What if there are 2 “start” codons?? AUG CGA AUG GAC UGG GAC CCA UAU UAG Start at the FIRST one and keep going until you hit a STOP!

  45. Answer Key # amino acids= 4 # amino acids= 8 # amino acids= 5 # amino acids= 4

  46. Translation Simulation (? Mins left) • You and your partner will receive mature mRNA transcripts • Pull the mRNA through the ribosome, & match up the correct tRNA • Record the amino acids that would be added to the growing chain • Figure out the secret phrase!

  47. Bellwork • Summarize the 4 steps of translation • What are the stop codons? • Describe the difference between tRNA and rRNA. • How should you organize the tRNAs out at the lab table? • Review your notes (quiz today)

  48. Translation Simulation (? Mins left) • You and your partner will receive mature mRNA transcripts • Pull the mRNA through the ribosome, & match up the correct tRNA • Record the amino acids that would be added to the growing chain • Figure out the secret phrase! **When finished… Work on the RNA Review sheet (in front if you don’t have it yet)

  49. Short-cut mRNA Codon Wheel Determine an amino acid sequence from the mature mRNA…without having to match up tRNAanticodons! AUG = Methionine (M)

  50. Try it out! Mature mRNA: AUG GAC CGA GUU AGC UGA GAU CUG Amino Acids: _ _ _ _ _ _ _ _ M D R V S stop Complete the amino acid sequences on your worksheet using the codon wheel

More Related