360 likes | 518 Views
PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers is amplified. The first PCR cycle: The sequence between the two primers will be amplified. Four cycles of PCR.
E N D
PCR is another in vitro DNA synthesis reactionThe twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers is amplified
The first PCR cycle:The sequence between the two primers will be amplified
Copy number of the sequence between the primers increases exponentially
SEQUENCIAMENTO DE DNA ORF Profa. Dra. Maria Aparecida Fernandez Depto de Biologia Celular e Genética Universidade Estadual de Maringá
Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist DNAP requires a template and a primer The primer is labeled so the DNA fragments synthesized can be detected by autoradiography. The [ddNTP] determines the distribution of chain lengths produced.
Filme de raio X Auto-radiograma Leitura manual Alto peso molecular TGGCTCGGCCTCAAGTCGAGGTTATCAGATCTGCAACTCAA Baixo peso molecular
Conjunto de 16 capilares