Trypanosomy v lidské krvi
Download
1 / 25

- PowerPoint PPT Presentation


  • 125 Views
  • Uploaded on

Trypanosomy v lidské krvi. Euglenids. Kinetoplastids. Diplonemids. Euglenozoans are unicellular flagellates that include free-living, commensalic and parasitic species. the sampling of trypanosomatids in Neotropical Heteroptera. Trypanosoma brucei. trypanosomes.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about '' - mirra


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Trypanosomy v lidsk krvi

Euglenids

Kinetoplastids

Diplonemids

Euglenozoans are unicellular flagellates that include

free-living, commensalic and parasitic species


Trypanosomy v lidsk krvi

the sampling of trypanosomatids in

Neotropical Heteroptera


Trypanosomy v lidsk krvi

Trypanosoma

brucei

trypanosomes

  • Kinetoplastid flagellates causing disease: >300.000.000 patients

  • worldwide

  • Leishmaniasis

  • Chagas’ disease

  • Sleeping sickness


Trypanosomy v lidsk krvi

tse-tse fly vector

T.brucei gambiense

T. brucei rhodesiense

T. brucei brucei

Trypanosoma brucei

distribution

life cycle


Trypanosomy v lidsk krvi

mitochondrion

kDNA is organized as a disc with minicircles stretched taut and aligned parallel to the axis of the kDNA disc

kDNA


Trypanosomy v lidsk krvi

Trypanosoma brucei

ND8

ND7

COIII

gRNA 1

ND9

CYb

A6

~1kb

22kb

CR3

gRNA 2

CR5

COII

gRNA 3

CR4

MURF2

RPS12

Kinetoplast (or kDNA) genome

of kinetoplastid flagellates


The kinetoplast dna r eplication m odel

Pol b-PAK

Topo II

Polb

Antipodal

site

SSE1

(RNase H)

Primase

Kinetoflagellar

Zone

UMSBP

Pol1B

+

Pol1C

The kinetoplast DNA replication model


Trypanosomy v lidsk krvi

Frataxin

(komplex ?)

IscA

IscS1

Ferredoxin 1

Ferredoxin 2

Zájmové mitochondriální proteiny

  • Fe-S klastery 2. RNA editing a RNA procesing

  • proteiny konzervované mezi člověkem, kvasinkou a trypanosomou o nichž

  • se nic neví

  • Podjednotky respiračního řetězce

  • Import a modifikace tRNA


Trypanosomy v lidsk krvi

GAP1 and 2 are lethal also in the bloodstream stage

Northern and Western analysis showing

downregulation of the GAP proteins

gRNAs disappear in the

absence of GAP proteins

Growth curves of GAP knock-downs


Trypanosomy v lidsk krvi

Fe

s

s

Cfd1

S

S

Fe

WD40

e

Hsp70

DnaJ

Mge

FOR-NADH

Fdx

ISC machinery

Fe

s

s

S

S

Nbp35

Fe

Narf

X?

mitochondrion

apoprotein

Erv1, GSH

Atm1?

Complex I

Fe

S

S

Ind

Fe

Grx5

Fe

S

S

ATP

Fe

Frataxin

apoprotein

0

S

S

IscU

TCA

substrate

2+

Fe

Fe

IscS

alanine

IscA

Isd11

Nfu

Iba57?

cysteine

Mrs3/4



Trypanosomy v lidsk krvi

T. brucei ATPase 6 mRNA

edited

editing in progress...

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUUGAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAUUGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGAUUUUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUUGAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAUUGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUUGAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAUUGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUUGAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAUUGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUUGAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAUUGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUUGAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAUUGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUUGAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUUGAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUUGAAAACACCCAUUUUUAGGAGGAUAAGAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUUGAAAACACCCAUUUUUAGGAGGAUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGAAAAGUAGGGGAAUUUUGAGGAGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAuAuuGCAuuuuuAuuuuuGuuuuGuuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGAAAAAGAAUUUUGAAUUUGAACuUAUUUG***AAuuuG*UAuuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGuuGuGGuuuAuGuuGuuuAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***AAuuuG*UAuuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGGAGACAGGAGAGGAuuuuAAuUGuuuAAuGuuGAuuuuuGAuuuuuuAuuAuuuuGuuuG*UUUGAuuuGuAuuuGuuuGuuGGuuuGuG***UUUGuuuuuAuuGuuGuGGuuuAuGuuGuuuAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***AAuuuG*UAuuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGuuuuuAuuuuuuuuuuGuGAuuuAUUUUGGuuGCGuuuGuuAuuAuGuAuGuAuuAuuGuGuAuGAuCuAGGuuAuGuuuuAuuGuGuAuuuuAAuUGuuuAAuGuuGAuuuuuGAuuuuuuAuuAuuuuGuuuG*UUUGAuuuGuAuuuGuuuGuuGGuuuGuG***UUUGuuuuuAuuGuuGuGGuuuAuGuuGuuuAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***AAuuuG*UAuuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAuAuGuuuuuAuuuuuuuuuuGuGAuuuAUUUUGGuuGCGuuuGuuAuuAuGuAuGuAuuAuuGuGuAuGAuCuAGGuuAuGuuuuAuuGuGuAuuuuAAuUGuuuAAuGuuGAuuuuuGAuuuuuuAuuAuuuuGuuuG*UUUGAuuuGuAuuuGuuuGuuGGuuuGuG***UUUGuuuuuAuuGuuGuGGuuuAuGuuGuuuAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***AAuuuG*UAuuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA

pre-edited

M K E K G F E R G V FW G E EK E FW IW T I C L S Y G R E A R R R K V G E FW G D S W G E A G G R R R FW K H P F L G GterE G R K G E M E L G I A F A K L L E E R A G K V R G R R E E R E S C D F G V I Eter D Q I Sterter

M F L F F F C DL F W L R L L L C M Y Y C VW S R L C FI V Y F N C L M L I F D F L L F C LF D L Y L F V G L CL F L L L W F M LF N L Y S L I L Y YC I T Y L N L Y LL F C I V F L L Y I A F L F L F C F L C D F F L F N N L L V G DS F M DV F F IR F L L C F L E C F S L L C RC L S T F L R L F C N L L S S H F L L L M F F D F F Y F I F V F F FW C F LL L I Y F I Y F C V L F L F I I L C V FI F V G F I CR H I TV I Y F Lter

M F L F F F C DL F W L R L L L C M Y Y C VW S R L C FI V Y F N C L M L I F D F L L F C LF D L Y L F V G L CL F L L L W F M LF N L Y S L I L Y YC I T Y L N L Y LL F C I V F L L Y I A F L F L F C F L C D F F L F N N L L V G DS F M DV F F IR F L L C F L E C F S L L C RC L S T F L R L F C N L L S S H F L L L M F F D F F Y F I F V F F FW C F LL L I Y F I Y F C V L F L F I I L C V FI F V G F I CR H I TV I Y F Lter


Trypanosomy v lidsk krvi

12S 9S ND8 ND7 cox3 cytb ATP6 G3 cox2 MURF2 ND4 RPS12 ND5

ND9 MURF5 MURF1 ND1 cox1 G4 ND3

edited mRNAs

In T. brucei, extensive RNA editing is the rule: 9 of 18 mRNAs

are extensively edited


Trypanosomy v lidsk krvi

Most edited mRNAs encode subunits ND4 RPS12 ND5

of the OxPhos system

Complex II

Complex III

Complex IV

Complex V

Complex I

Succinate

reductase

II

6

(a)

7

8

III

CYb

9

3

Subunits encoded by mitochondrial mRNAs that require editing


Trypanosomy v lidsk krvi

Editing Block ND4 RPS12 ND5

RNA editing is directed by guide RNAs

...AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGAUUUUGGAGUUAUAG...

|·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...GCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG...

||··||||·||·||·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGAUUGGAGUUAUAG...

||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGuuAUUGGAGUUAUAG...

·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...AGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGuuUGuuAUUGGAGUUAUAG...

·||·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGGuuUGuuAUUGGAGUUAUAG...

|·||·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...GAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAuuuGGuuUGuuAUUGGAGUUAUAG...

·||||·||·||·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...GAAAGGUUAGGGGGAGGAGAGAAGAAAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG...

||···|||··||||·||·||·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...AGGAAAGGUUAGGGGGAGGAGAGAAGAAAGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG...

··|||··||||·||·||·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...AAAGGUUAGGGGGAGGAGAGAAGAAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG...

||||···|||··||||·||·||·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...AGGUUAGGGGGAGGAGAGAAGAuuAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG...

||·||||···|||··||||·||·||·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...GUUAGGGGGAGGAGAGAAGuuAuuAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG...

|·||||·||||···|||··||||·||·||·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

...UUAGGGGGAGGAGAGAuAGuuAuuAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG...

····|··|·|·|||·||||·||||···|||··||||·||·||·|||||·||||||||||

UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...

U Tail

Information

Anchor


Trypanosomy v lidsk krvi

gRNAs ND4 RPS12 ND5

VIII VI IV II

u

u

u

u

cox3 mRNA

u

u

u

u

A

gRNAs

VII V III I

n

edited

3'

5'

Direction of editing

unedited

RNA editing of one mRNA requires several gRNAs


Trypanosomy v lidsk krvi

Editosome Model ND4 RPS12 ND5

p24

p42

p18

upstream

binding

p63

p90

p81

p99

p52

p48

p108

p69

p57

p46

p102

p67

catalytic

hel61

p61

p101

p103

EM

p33

p105

p44

anchor

binding

p41

Insertion editing Deletion editing


Trypanosomy v lidsk krvi

RNA editing ND4 RPS12 ND5

The core machinery: the 20 S editosome

Stuart et al., Trends Genet. 2005


Trypanosomy v lidsk krvi

Crystal structure of the MRP ND4 RPS12 ND51/MRP2 complex

Ribbon diagram with MRP1 in red (subunits A and C)

and MRP2 in cyan (subunits B and D)

Schumacher et al., Cell 2006


Trypanosomy v lidsk krvi

The GAP proteins are ND4 RPS12 ND5

localized in punctuate

loci along the reticulated

mitochondrion

Immunolocalization using

anti-GAP1 antibody

Immunolocalization of the

HA3-tagged versions of

GAP1 and GAP2

Hashimi et al.,

RNA, 2009



Gradual los s of kinetoplast dna
Gradual los ND4 RPS12 ND5s of kinetoplast DNA

Without kDNA they cannot survive in

tse-tse fly but can in mammals (after

some compensatory mutations)


Trypanosomy v lidsk krvi

Figure 5 ND4 RPS12 ND5

Trypanosoma brucei with kDNA

Trypanosoma evansi

without kDNA

(akinetoplastic;

“petite mutant”)

Editosome and accessory proteins are present even in trypanosomes

that have completely lost their mitochondrial DNA (+ RNA)

Lai et al., PNAS, 2008