analyzing nuclear and mitochondrial genetic diversity in the alaska blackfish dallia pectoralis l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Analyzing nuclear and mitochondrial genetic diversity in the Alaska Blackfish ( Dallia pectoralis ) PowerPoint Presentation
Download Presentation
Analyzing nuclear and mitochondrial genetic diversity in the Alaska Blackfish ( Dallia pectoralis )

Loading in 2 Seconds...

play fullscreen
1 / 17

Analyzing nuclear and mitochondrial genetic diversity in the Alaska Blackfish ( Dallia pectoralis ) - PowerPoint PPT Presentation


  • 221 Views
  • Uploaded on

Analyzing nuclear and mitochondrial genetic diversity in the Alaska Blackfish ( Dallia pectoralis ) .  Rachel DeWilde  University of Alaska Fairbanks  EPSCoR All-Hands Meeting 2011. Overview. The Alaska Blackfish Genetic Analysis Sequencing Mitochondrial DNA

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Analyzing nuclear and mitochondrial genetic diversity in the Alaska Blackfish ( Dallia pectoralis )' - maxima


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
analyzing nuclear and mitochondrial genetic diversity in the alaska blackfish dallia pectoralis

Analyzing nuclear and mitochondrial genetic diversity in the Alaska Blackfish (Dallia pectoralis)

Rachel DeWilde University of Alaska Fairbanks EPSCoR All-Hands Meeting 2011

overview

Overview

  • The Alaska Blackfish
  • Genetic Analysis
    • Sequencing Mitochondrial DNA
      • Microsatellites
    • Genotyping Microsatellites
  • 454 sequencing
    • Developing primer candidates
the alaska blackfish

The Alaska Blackfish

Fresh water fish

Poor swimmers

Short life span

Prefer shallow vegetated habitats

geographic barriers

Geographic Barriers

  • Brooks range
  • Yukon River
  • Tanana River
slide5

Collection Localities

North Slope: 2

Interior: 4

Coast: 8

Russia: 3

=17 Sampling sites

24

24 sampling locations

slide6

Interior

Coast

Russia

North Slope

Sequencing mtDNA

Coast

Naknek: 10 Galena: 17

Galena

Coast

biparentally inherited mutation rate saturate the genome

Microsatellites

AGTA CCGTACTGAGCGTACTGAG AGTAGTAGTAGTAGT ACGGCAAATCGTATATTCGA GCG

Biparentally inherited

Mutation rate

Saturate the genome

slide8

ACACAC AC ACACACACDinucleotideACACACACACACACA

ACGACG ACG ACGACGACG Trinucleotide ACGACGACGACGA

GTACGT ACGT ACGTACGTTetranucleotideACGTACGTACG

slide9

Genotyping Microsatellites

Dinucleotide differences:

North Slope & Russia 1 repeat

North Slope & Interior 3 repeats

North Slope & Galena 5 repeats [at most]

developing microsatellites using 454 sequencing

Developing Microsatellites Using 454 Sequencing

Initial study:

2009

13 polymorphic microsatellite loci

7,000 microsatellites

-66%

-33%

=10-100

microsatellites

primer design process
Primer Design Process

1. Extract DNA from one individual

2. Check DNA quality

3. Export to facility

4. Filter sequence results

1. Fresh Fairbanks Fish

2. Nanodrop

3. Duke genome sequencing and

analysis facility

4. Msatcommander

duke results

Duke Results

  • 123,109 microsatellites

Msatcommander search

slide13

6 repeats

12 repeats

247 microsatellites

62 primers

27 candidate primers

65 Microsatellites

10 primers

5 candidate primers

12x trial

Interior North Slope

N Interior North Slope Coast Galena

Interior North Slope Coast Galena N

12x trial

L

CLC8X

B74AX

B2BSZ

Interior North Slope Coast Galena N

BWBSP

B2BSZ

CGIUZ

Coast Galena N

Interior North Slope Coast Galena N

L

future research

Future Research

Galena sequencing

6 repeat microsatellites

12 repeat microsatellites

Candidate primer genotyping

acknowledgements

Hosted by:

the Lopez lab

  • MathewCampbell
    • Mentor
  • Andres Lopez
    • Advisor
Acknowledgements

Funded by:

EPSCoR

Partial funding from:

  • The Center for Research Services
  • INBRE

IDea Network for Biomedical Research

Questions