marla
Uploaded by
46 SLIDES
693 VIEWS
480LIKES

Chapter 14.

DESCRIPTION

Chapter 14. From Gene to Protein. A. B. C. D. E. Genes create phenotype. Metabolism teaches us about genes. Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

1 / 46

Download Presentation

Chapter 14.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 14. From Gene to Protein Biology 114

  2. A B C D E Genescreatephenotype Metabolism teaches us about genes • Metabolic defects • studying metabolic diseases suggested that genes specified proteins • alkaptonuria (black urine from alkapton) • PKU (phenylketonuria) • each disease is caused by non-functional enzyme

  3. 1 gene – 1 enzyme hypothesis • Beadle & Tatum • Compared mutants of bread mold, Neurospora fungus • created mutations by X-ray treatments • X-rays break DNA • inactivate a gene • wild type grows on “minimal” media • sugars + required precursor nutrient to synthesize essential amino acids • mutants require added amino acids • each type of mutant lacks a certain enzyme needed to produce a certain amino acid • non-functional enzyme = broken gene

  4. 1941 | 1958 Beadle & Tatum George Beadle Edward Tatum

  5. Beadle & Tatum’s Neurospora experiment

  6. Where doesthat leaveus?! So… What is a gene? • One gene – one enzyme • but not all proteins are enzymes • but all proteins are coded by genes • One gene – one protein • but many proteins are composed of several polypeptides • but each polypeptide has its own gene • One gene – one polypeptide • but many genes only code for RNA • One gene – one product • but many genes code for more than one product …

  7. It’s hard to hunt for wabbits, if you don’t knowwhat a wabbitlooks like. polypeptide 1 polypeptide 2 polypeptide 3 Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene RNA gene

  8. For simplicity sake, let’s go back togenes that codefor proteins… The “Central Dogma” • How do we move information from DNA to proteins? transcription translation DNA RNA protein replication

  9. From nucleus to cytoplasm… • Where are the genes? • genes are on chromosomes in nucleus • Where are proteins synthesized? • proteins made in cytoplasm by ribosomes • How does the information get from nucleus to cytoplasm? • messenger RNA nucleus

  10. RNA • ribose sugar • N-bases • uracil instead of thymine • U : A • C : G • single stranded • mRNA, rRNA, tRNA, siRNA…. transcription DNA RNA

  11. Transcription • Transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • Synthesis of complementary RNA strand • transcription bubble • Enzyme • RNA polymerase

  12. Transcription in Prokaryotes • Initiation • RNA polymerase binds to promoter sequence on DNA Role of promoter 1. Where to start reading = starting point 2. Which strand to read = template strand 3. Direction on DNA = always reads DNA 3'5'

  13. Transcription in Prokaryotes • Promoter sequences RNA polymerase molecules bound to bacterial DNA

  14. Transcription in Prokaryotes • Elongation • RNA polymerase unwinds DNA ~20 base pairs at a time • reads DNA 3’5’ • builds RNA 5’3’ (the energy governs the synthesis!) • No proofreading • 1 error/105 bases • many copies • short life • not worth it!

  15. Transcription RNA

  16. Transcription in Prokaryotes • Termination • RNA polymerase stops at termination sequence • mRNA leaves nucleus through pores RNA GC hairpin turn

  17. Transcription in Eukaryotes Biology 114

  18. Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Prokaryote vs. Eukaryote genes Exon: Segmnent of DNA that is both transcribed into RNA and translated into protein Intron: Portion of mRNA as transcribed from Eukaryotic DNA that is removed by enzymes before mRNA is translated into proteins intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

  19. Transcription in Eukaryotes • 3 RNA polymerase enzymes • RNA polymerase I • only transcribes rRNA genes • RNA polymerase I I • transcribes genes into mRNA • RNA polymerase I I I • only transcribes tRNA genes • each has a specific promoter sequence it recognizes

  20. Transcription in Eukaryotes • Initiation complex • transcription factors prokarytoes have 1 the holoenzyme, bind to promoter region upstream of gene • proteins which bind to DNA & turn on or off transcription • TATA box binding site like a prokaryote, too simple, additional control for time and tissue specific. • only then does RNA polymerase bind to DNA

  21. 3' poly-A tail 3' A A A A A mRNA 5' cap P P P 5' G CH3 Post-transcriptional processing • Primary difference between Pro&Euk • Primary transcript • eukaryotic mRNA needs work after transcription • Protect mRNA • from RNase enzymes in cytoplasm • add 5' cap • add polyA tail • Edit out introns 50-250 A’s intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript mature mRNA transcript spliced mRNA

  22. 5’ CAP 3’ Poly Tail “PROTECTION” • Eukaryotes ; The first base in transcript is usually A or G and modified by GTP to the 5’ PO4 group forming a 5’ Cap. The G nucleotide in the cap is joined to the transcript by its 5’ end making the only 5’ to 5’ bond. This protects the mRNA cap from degradation. • The Euk transcript is cleaved downstream from (AAUAAA) A series of residues called the 3’ poly a tail are added by poly-A-polymerase. Adds protection.

  23. Transcription to translation • Differences between prokaryotes & eukaryotes • time & physical separation between processes • RNA processing

  24. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing needed

  25. aa aa ribosome aa aa aa aa aa aa From gene to protein transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm

  26. Removing Introns • Intron: Non-coding sequence 24% out of human genome • Exon: expressed 1% encode for proteins • Pre-mRNA splicing in the nucleus • snRNP cluster to make splicesosome which recognize and cut out introns.

  27. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

  28. 1960 | 1968 Cracking the code • Nirenberg & Matthaei • determined 1st codon–amino acid match • UUU coded for phenylalanine • created artificial poly(U) mRNA • added mRNA to test tube of ribosomes, tRNA & amino acids • mRNA synthesized single amino acid polypeptide chain phe–phe–phe–phe–phe–phe

  29. Heinrich Matthaei Marshall Nirenberg

  30. Translation • Codons • blocks of 3 nucleotides decoded into the sequence of amino acids

  31. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

  32. The code • For ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid Why is this a good thing? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  33. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3' 5' TACGCACATTTACGTACGCGG DNA 5' 3' AUGCGUGUAAAUGCAUGCGCC mRNA codon 3' 5' tRNA aminoacid anti-codon

  34. cytoplasm transcription translation protein nucleus

  35. tRNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3' end

  36. Loading tRNA • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • endergonic reaction • ATP  AMP • energy stored in tRNA-amino acid bond • unstable • so it can release amino acid at ribosome

  37. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small

  38. Ribosomes • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • E site (exit site) • empty tRNA leaves ribosome from exit site

  39. Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, proteins & initiator tRNA • Elongation • Termination

  40. Elongation: growing a polypeptide

  41. Termination: release polypeptide • Release factor • “release protein” bonds to A site • bonds water molecule to polypeptide chain Now what happens to the polypeptide?

  42. Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm Protein targeting • Signal peptide • address label start of a secretory pathway

  43. RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNAsynthetase polyA tail 3' large subunit polypeptide ribosome 5' tRNA small subunit E P A

  44. Put it all together…

  45. Any Questions?? Biology 114

More Related