marisol
Uploaded by
34 SLIDES
464 VIEWS
340LIKES

Understanding Cypress Canker: Genetic Origins and Impacts on Plant Communities

DESCRIPTION

Explore the genetic studies and ecological impacts of Cypress canker, Heterobasidion, and Armillaria, along with the emergence of exotic plant diseases in California. Learn about the introduction of pathogens, such as Phytophthora ramorum, and how humans can unknowingly transport them. Delve into genetic structures, evolutionary backgrounds, and implications for plant health. Discover the interconnectedness between pathogens, host plants, and environmental factors shaping forest ecosystems.

1 / 34

Download Presentation

Understanding Cypress Canker: Genetic Origins and Impacts on Plant Communities

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. SUMMARY • Cypress canker • Infectious propagules called conidia are multicelled, genetically identical to parent, and need a wound to infect • Genetic studies reveal one clone in Europe and many in California • Disease caused by exotic pathogen in Europe and by off site planting and exotic host in California

  2. Conidia of Seiridium cardinale observed by optical microscope and SEM

  3. SUMMARY • Heterobasidion • Primary infection caused by airborne genetically distinct basidiospores • Secondary infection of adjacent trees caused by direct root to root contact • Host specificity of H.irregulare vs. H. occidentale • Stumps main infection courts for H. irregulare on pine/juniper, wounds for true fir/sequoia • Environmental changes increase abundance of this root and bole pathogen • Armillaria (Honey mushroom) • Mostly secondary infection thanks to rhizomorphs, largest organism in the world

  4. True firs Pines Each spore is a genetically different individual: In pines we found the same genetic individual in stumps and adjacent trees indicating direct contagion between the two In true firs and true firs/sequoias we find same individual in adjacent standing trees indicating infection not linked to stumps but to wounds on standing trees

  5. “Emergent diseases”:3: exotic pathogens • 99% of times human responsible for their introduction

  6. Like the conquistadores brought diseases that were lethal to those who had never been exposed to them, so do exotic diseases cause true devastation in plant communities because of lack of coevolution between hosts and microbes

  7. California invaded: 1849 A.D. Port Orford Cedar Root Disease 1950s New hybrid root pathogen 1990s Manzanita/madrone die-back Sudden Oak Death 1990s White pine blister rust 1930s Canker-stain of Sycamores 1980’s Dutch Elm Disease 1960s Pitch canker disease 1980s Oak root canker 2000

  8. How can people transport pathogens • By transporting plants and plant parts • Crops, and seeds • Raw food • Ornamental plants Untreated lumber Soil Insects vectoring fungi Military activity

  9. The Irish Potato Famine • From 1845 to 1850 • Phytophthora infestans • Resulted in the death of 750,000 • Emigration of over 2 million, mainly to the United States.

  10. Girdling aerial ‘cankers’ removed from roots

  11. Big Sur 2006 K. Frangioso

  12. P. ramorum absent P. ramorum present Wickland et al., unpublished

  13. P. ramorum growing in a Petri dish

  14. Organism new to science • Origin unknown • Biology unknown • Symptoms caused unknown • Immediately though highly regulated

  15. Rhododendron: In EU mostly a nursery issue, but also present in nurseries in US and Canada Stem canker Leaf necrosis

  16. Sporangia Phytophthora ramorum Chlamydospores

  17. Is it exotic? • Our studies have indicated that California population is extremely simplified, basically two strains reproducing clonally as expected of an introduced organism • Many hosts appear to have no resistance at all • Limited geographic distribution

  18. Where does it come from? • It is unknown where pathogen originally comes from, but previous studies have shown that California forest population is derived from a relatively genetically diversified US nursery population, indicating ornamental nurseries were the most likely avenue for pathogen introduction

  19. Let’s look at its genetic structure • Need a number of independent and neutral DNA markers • Used AFLP, a technique that scans the entire nuclear genome • Are our isolates the same as the European ones? • Is the genetic structure suggestive of an introduced or native species?

  20. US forest isolates clearly distinct from EU nursery isolates, also have different mating type • Isolates from nurseries in WA, OR, & BC both of the US and EU types • Potential for XXX sex and recombination in US nurseries • US forest population is genetically very homogeneous, trademark of an introduced species

  21. The entire genome was sequenced in less than 3 years since discovery of organism * 12 SSR loci (di- and tri- repeats identified) * Loci selected to be polymorphic both between and within continental populations * 500+ representative isolates analyzed CCGAAATCGGACCTTGAGTGCGGAGAGAGAGAGAGACTGTACGAGCCCGAGTCTCGCAT

  22. Mating Type A1 A2 A2 Growth Rate Fast Slow Fast

  23. Terminology Genotype Lineage Population

  24. Results of 1st microsatellite study • There actually three distinct (genotypically and phenotypically) lineages of P. ramorum • Very low diversity in US forests (microsats cannot discriminate among individuals, clonality confirmed), only one lineage • Several genotypes but only one lineage in EU nurseries • Three lineages in US nurseries

  25. Was the pathogen first in US forests or in US nurseries? Slide 12

  26. Was the pathogen first in US forests or in US nurseries? Slide 12 nurseries forests

  27. Positive isolation P. ramorum Where was it introduced? • First reports mid 90’s • Pathogen identified in 2000 • By then, the pathogen was widespread • CLUES: severity of symptoms and anedoctal stories

  28. We found same genotypes in nurseries and forests proving origin of wild outbreak

  29. nurseries Introduction phase 1- Escape of pathogen from Infected nursery plants at two locations: Mount Tamalpais (Marin County), and Scott’s Valley (Santa Cruz County) 2- Nurseries and two sites have identical strain composition, but distance between sites is impossible for natural spread of organism

  30. What favors invasion of exotic fungi ? • Density of host increases severity of disease • Corridors linking natural habitats • Synchronicity between host susceptibility and pathogen life cycle • Ecological and environmental conditions

  31. Bay/Oak association Bay Coast Live Oak (no sporulation) Canker margin in phloem Bleeding canker Sporangia

  32. Mantel test among all individuals. [Moran’s I vs ln (geographic distance)]

More Related