1 / 20

DNA Repair Pathways in Mammals: Unveiling the Rat PCNA Promoter Sequences

This thesis outlines the 3D DNA BER pathways in mammals, focusing on nucleotide excision repair and the sequences and organization of the rat PCNA promoter. It examines regulatory elements like AP-1 and ATF/CRE and explores the activation of p53-mediated gene expression in response to DNA damage. Additionally, it delves into the metabolic pathways of reactive oxygen radicals and DNA-PK chapter. The use of EMSA and HPVE6 in chapter 4 shed light on this complex topic.

lulu
Download Presentation

DNA Repair Pathways in Mammals: Unveiling the Rat PCNA Promoter Sequences

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. 3D

  2. Outline of the DNA BER pathways in mammals

  3. Nucleotides excision repair

  4. Sequences and organization of rat PCNA promoter

  5. Rat PCNA Promoters -693 -240 -70 +125 CAT d693 d240 d70 -70 +125 AP-1 ATF/CRE TGGGTCAGCGCTGTGACGCCA (-64/-58) (-51/-44) UV Serum

  6. UV PCNA

  7. Activation of p53-mediated gene expression in response to DNA damage

  8. Metabolic pathways of reactive oxygen radicals

  9. Outline of the thesis UV other DNA-PK chapter 2 ATF-1 chapter 2 ? EMSA HPVE6 chapter 4 chapter 3 ? PCNA promoter mRNA protrein chapter 2

More Related