lotus
Uploaded by
21 SLIDES
6039 VIEWS
2020LIKES

Primer Design

DESCRIPTION

Primer Design. Dave Palmer dpalmer@zdap.com. Why Are Primers Important?. Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great. Bad primer design: PCR works terrible. Very-Brief PCR Reminder.

1 / 21

Download Presentation

Primer Design

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Primer Design Dave Palmer dpalmer@zdap.com

  2. Why Are Primers Important? • Primers are what gives PCR its SPECIFICITY!!! • Good primer design: PCR works great. • Bad primer design: PCR works terrible.

  3. Very-Brief PCR Reminder • PCR is a method to amplify large quantities of a DNA covering a specific sequence.

  4. Factors That Affect Priming • Melting / Annealing Temperature • Of primers to target • Secondary Structure • Within target • Complementarity • Primers to target • Primers to each other

  5. Factor 1:Melting / Annealing Temperature aagtcagtcagtactagtgatgta aagtcagtcag • PRIMER LENGTH • Longer primers stick better = melt at a higher temperature. • GC CONTENT • More G-C content = more triple bonds = primers stick better = melt at higher temperature. • PCR Annealing Temp = Melt T - 5°C • Tm = [4(G + C) + 2(A + T)] °C • Tm = 58.3°C + 0.41°C (%G-C) - 500/length http://www.alkami.com/primers/refprmr.htm

  6. Factor 2:Secondary Structure • Primers will have difficulty annealing: if they anneal to regions of secondary structure within the target that have a higher melting point than the primer. http://www.alkami.com/primers/refprmr.htm

  7. Factor 3:Complementarity • PRIMER-PRIMER (BAD) • Excessive similarity between primers, especially at the 3’ ends, leads to the formation of “primer dimers” • PRIMER-TARGET (GOOD) • Ideally should be 100% similar for maximal specificity. • Primers don’t HAVE to be perfectly similar to target to work. atcggactatcga gctatacttatggcca atcggactatcga tagcctgatagctatacttatggcca http://www.alkami.com/primers/refprmr.htm

  8. What is a Primer-Dimer • An unwanted extension product • Results from primers annealing to themselves, or each other, at 3’ ends • Extended primers are no longer available to prime target for PCR atcggactatcga gctatacttatggcca atcggactatcgatatgaataccgga tagcctgatagctatacttatggcca

  9. Two Strategies for Primer Design • Pick a primer pair and optimize PCR conditions for it. • If an exact sequence site needs to be primed or amplified. • If you’re working with someone else’s primers. • Optimize the primer design to work in a specific set of PCR conditions. • If you’ve got flexibility around the amplified site. • Allows more “standardized” PCR conditions. ?

  10. Strategy 1 for Primer Design: Fixed Primers, Vary Conditions • With a given primer pair, the Tm can be calculated. • Run multiple PCR reactions, each using a different annealing temperature (= Tm - 5). • “Bracket” Ta: – 10C, -5C, 0C, +5C, +10C • Temp too low: Smearing due to non-specific priming • Temp too high: No amplification due to no priming • Choose conditions which give the best results. http://www.iscpubs.com/pubs/abl/articles/b9812/b9812pre.pdf

  11. Strategy 2 for Primer Design:Optimizing Primers for Set Conditions • PCR conditions (esp. annealing temp) are kept constant. • Select primers for a theoretical Tm. • Best to select multiple primers, then experiment to see which combination works best. F1: atcgatcgatcgatcagtcatcg F2: gtactgagctagctgcagctc R1: atgactgagctgctagcttg R2: atgcatgctcgtgactgtg F2 F2 R1 F1/R1 F2/R1 R2 F1/R2 F2/R2 95C – 65C – 72C

  12. Designing Primers • Primer Design on the Web • Example: “Primer3” • Example gene: GFP5 Green Fluorescent Protein • GFP5, Genebank 1848286 http://frodo.wi.mit.edu/ 1 ggatccaagg agatataaca atgagtaaag gagaagaact tttcactgga gttgtcccaa 61 ttcttgttga attagatggt gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg 121 aaggtgatgc aacatacgga aaacttaccc ttaaatttat ttgcactact ggaaaactac 181 ctgttccatg gccaacactt gtcactactt tctcttatgg tgttcaatgc ttttcaagat 241 acccagatca tatgaagcgg cacgacttct tcaagagcgc catgcctgag ggatacgtgc 301 aggagaggac catcttcttc aaggacgacg ggaactacaa gacacgtgct gaagtcaagt 361 ttgagggaga caccctcgtc aacaggatcg agcttaaggg aatcgatttc aaggaggacg 421 gaaacatcct cggccacaag ttggaataca actacaactc ccacaacgta tacatcatgg 481 ccgacaagca aaagaacggc atcaaagcca acttcaagac ccgccacaac atcgaagacg 541 gcggcgtgca actcgctgat cattatcaac aaaatactcc aattggcgat ggccctgtcc 601 ttttaccaga caaccattac ctgtccacac aatctgccct ttcgaaagat cccaacgaaa 661 agagagacca catggtcctt cttgagtttg taacagctgc tgggattaca catggcatgg 721 atgaactata caaataagag ctc

  13. Designing Primers • Primer Design on the Web Using Primer3 Enter sequence Pick Primers

  14. Designing Primers • Primer3 Advanced Controls Primer Size Primer Tm Complementarity

  15. Designing Primers • Primer3 Output • Details: • Start • Length • Tm • GC • Sequence Where they bind:

  16. Designing Primers • Primer 3 Output, continued

  17. Primer Evaluation TCATTGTTTGCCTCCCTGC TAGAAACCCCAACCCGTGAAA • Let’s assume we selected the first primer pair (for + rev) • Website for online primer evaluation: Enter Sequence

  18. Primer Evaluation • Website displays potential problems with primer self-annealing • More advanced software can examine interactions between primers TCATTGTTTGCCTCCCTGC TAGAAACCCCAACCCGTGAAA Graphical Output

  19. Primer Evaluation GGGCCCCTCACCAACCCGTGCCCGGG • Just for fun, let’s assume we selected a really BAD primer...

  20. Live Example Primer Design Primer Design Workflow: 1. Pick a gene. ie. BRCA1 2. Pull up sequence for the gene. a. http://www.ncbi.nlm.nih.gov/ b. search Nucleotide Database for brca1 c. scroll through accessions for desired one 3. Copy sequence to text editor. 4. Pull up a primer design website. a. http://frodo.wi.mit.edu/ b. copy sequence c. select options and choose Pick Primers 4b. Verify primers find target (optional) a. http://www.ncbi.nlm.nih.gov/BLAST/ b. select nucleotide blast c. enter primer sequence, choose blast 4c. Analyse and double-check the primers a. http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/Default.aspx b. enter sequence, view 5. Order oligos. a. http://www.operon.com

  21. End of Primer Design

More Related