primer design n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Primer Design PowerPoint Presentation
Download Presentation
Primer Design

Loading in 2 Seconds...

play fullscreen
1 / 21

Primer Design - PowerPoint PPT Presentation


  • 651 Views
  • Uploaded on

Primer Design. Dave Palmer dpalmer@zdap.com. Why Are Primers Important?. Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great. Bad primer design: PCR works terrible. Very-Brief PCR Reminder.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Primer Design' - lotus


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
primer design

Primer Design

Dave Palmer

dpalmer@zdap.com

why are primers important
Why Are Primers Important?
  • Primers are what gives PCR its SPECIFICITY!!!
  • Good primer design: PCR works great.
  • Bad primer design: PCR works terrible.
very brief pcr reminder
Very-Brief PCR Reminder
  • PCR is a method to amplify large quantities of a DNA covering a specific sequence.
factors that affect priming
Factors That Affect Priming
  • Melting / Annealing Temperature
    • Of primers to target
  • Secondary Structure
    • Within target
  • Complementarity
    • Primers to target
    • Primers to each other
factor 1 melting annealing temperature
Factor 1:Melting / Annealing Temperature

aagtcagtcagtactagtgatgta

aagtcagtcag

  • PRIMER LENGTH
    • Longer primers stick better = melt at a higher temperature.
  • GC CONTENT
    • More G-C content = more triple bonds = primers stick better = melt at higher temperature.
  • PCR Annealing Temp = Melt T - 5°C
  • Tm = [4(G + C) + 2(A + T)] °C
  • Tm = 58.3°C + 0.41°C (%G-C) - 500/length

http://www.alkami.com/primers/refprmr.htm

factor 2 secondary structure
Factor 2:Secondary Structure
  • Primers will have difficulty annealing:

if they anneal to regions of secondary structure within the target that have a higher melting point than the primer.

http://www.alkami.com/primers/refprmr.htm

factor 3 complementarity
Factor 3:Complementarity
  • PRIMER-PRIMER (BAD)
    • Excessive similarity between primers, especially at the 3’ ends, leads to the formation of “primer dimers”
  • PRIMER-TARGET (GOOD)
    • Ideally should be 100% similar for maximal specificity.
    • Primers don’t HAVE to be perfectly similar to target to work.

atcggactatcga

gctatacttatggcca

atcggactatcga

tagcctgatagctatacttatggcca

http://www.alkami.com/primers/refprmr.htm

what is a primer dimer
What is a Primer-Dimer
  • An unwanted extension product
  • Results from primers annealing to themselves, or each other, at 3’ ends
  • Extended primers are no longer available to prime target for PCR

atcggactatcga

gctatacttatggcca

atcggactatcgatatgaataccgga

tagcctgatagctatacttatggcca

two strategies for primer design
Two Strategies for Primer Design
  • Pick a primer pair and optimize PCR conditions for it.
    • If an exact sequence site needs to be primed or amplified.
    • If you’re working with someone else’s primers.
  • Optimize the primer design to work in a specific set of PCR conditions.
    • If you’ve got flexibility around the amplified site.
    • Allows more “standardized” PCR conditions.

?

strategy 1 for primer design fixed primers vary conditions
Strategy 1 for Primer Design: Fixed Primers, Vary Conditions
  • With a given primer pair, the Tm can be calculated.
  • Run multiple PCR reactions, each using a different annealing temperature (= Tm - 5).
  • “Bracket” Ta: – 10C, -5C, 0C, +5C, +10C
  • Temp too low: Smearing due to non-specific priming
  • Temp too high: No amplification due to no priming
  • Choose conditions which give the best results.

http://www.iscpubs.com/pubs/abl/articles/b9812/b9812pre.pdf

strategy 2 for primer design optimizing primers for set conditions
Strategy 2 for Primer Design:Optimizing Primers for Set Conditions
  • PCR conditions (esp. annealing temp) are kept constant.
  • Select primers for a theoretical Tm.
  • Best to select multiple primers, then experiment to see which combination works best.

F1: atcgatcgatcgatcagtcatcg

F2: gtactgagctagctgcagctc

R1: atgactgagctgctagcttg

R2: atgcatgctcgtgactgtg

F2 F2

R1 F1/R1 F2/R1

R2 F1/R2 F2/R2

95C – 65C – 72C

designing primers
Designing Primers
  • Primer Design on the Web
    • Example: “Primer3”
  • Example gene: GFP5 Green Fluorescent Protein
    • GFP5, Genebank 1848286

http://frodo.wi.mit.edu/

1 ggatccaagg agatataaca atgagtaaag gagaagaact tttcactgga gttgtcccaa 61 ttcttgttga attagatggt gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg 121 aaggtgatgc aacatacgga aaacttaccc ttaaatttat ttgcactact ggaaaactac 181 ctgttccatg gccaacactt gtcactactt tctcttatgg tgttcaatgc ttttcaagat 241 acccagatca tatgaagcgg cacgacttct tcaagagcgc catgcctgag ggatacgtgc 301 aggagaggac catcttcttc aaggacgacg ggaactacaa gacacgtgct gaagtcaagt 361 ttgagggaga caccctcgtc aacaggatcg agcttaaggg aatcgatttc aaggaggacg 421 gaaacatcct cggccacaag ttggaataca actacaactc ccacaacgta tacatcatgg 481 ccgacaagca aaagaacggc atcaaagcca acttcaagac ccgccacaac atcgaagacg 541 gcggcgtgca actcgctgat cattatcaac aaaatactcc aattggcgat ggccctgtcc 601 ttttaccaga caaccattac ctgtccacac aatctgccct ttcgaaagat cccaacgaaa 661 agagagacca catggtcctt cttgagtttg taacagctgc tgggattaca catggcatgg 721 atgaactata caaataagag ctc

designing primers1
Designing Primers
  • Primer Design on the Web Using Primer3

Enter sequence

Pick Primers

designing primers2
Designing Primers
  • Primer3 Advanced Controls

Primer Size

Primer Tm

Complementarity

designing primers3
Designing Primers
  • Primer3 Output
  • Details:
  • Start
  • Length
  • Tm
  • GC
  • Sequence

Where they bind:

designing primers4
Designing Primers
  • Primer 3 Output, continued
primer evaluation
Primer Evaluation

TCATTGTTTGCCTCCCTGC

TAGAAACCCCAACCCGTGAAA

  • Let’s assume we selected the first primer pair (for + rev)
  • Website for online primer evaluation:

Enter Sequence

primer evaluation1
Primer Evaluation
  • Website displays potential problems with primer self-annealing
  • More advanced software can examine interactions between primers

TCATTGTTTGCCTCCCTGC

TAGAAACCCCAACCCGTGAAA

Graphical

Output

primer evaluation2
Primer Evaluation

GGGCCCCTCACCAACCCGTGCCCGGG

  • Just for fun, let’s assume we selected a really BAD primer...
live example primer design
Live Example Primer Design

Primer Design Workflow:

1. Pick a gene.

ie. BRCA1

2. Pull up sequence for the gene.

a. http://www.ncbi.nlm.nih.gov/

b. search Nucleotide Database for brca1

c. scroll through accessions for desired one

3. Copy sequence to text editor.

4. Pull up a primer design website.

a. http://frodo.wi.mit.edu/

b. copy sequence

c. select options and choose Pick Primers

4b. Verify primers find target (optional)

a. http://www.ncbi.nlm.nih.gov/BLAST/

b. select nucleotide blast

c. enter primer sequence, choose blast

4c. Analyse and double-check the primers

a. http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/Default.aspx

b. enter sequence, view

5. Order oligos.

a. http://www.operon.com