arlo
Uploaded by
45 SLIDES
799 VIEWS
470LIKES

DIY Primer Design

DESCRIPTION

DIY Primer Design. Oligonucleotides for Special Applications in Molecular Biology Alberto Catalano Kanematsu Labs, Institute of Haematology RPAH alberto.catalano@email.cs.nsw.gov.au Ph: 9515 7453 http://users.bigpond.net.au/albert/primers.htm. Outline. DNA Refresher: “DNA 101” PCR

1 / 45

Download Presentation

DIY Primer Design

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DIY Primer Design Oligonucleotides for Special Applications in Molecular Biology Alberto Catalano Kanematsu Labs, Institute of HaematologyRPAH alberto.catalano@email.cs.nsw.gov.au Ph: 9515 7453 http://users.bigpond.net.au/albert/primers.htm

  2. Outline • DNA Refresher: “DNA 101” • PCR • Introduction • Oligonucleotide Primers for PCR • Properties • Specificity • Self complementarity & primer-primer interactions • General rules • Primer Design • Computer programmes: on internet & on PC • Special PCR Applications

  3. DNA 101 The “Basics”

  4. B-DNA 2nm • Common form of DNA • Formed under high humidity conditions • Right-handed double helix • Major groove & minor groove • Sugar-phosphate backbones 3.4nm 10 nucleotides per turn Ramaswamy H. Sarma 1996

  5. Sugar + Phosphate + Base Sugar + Phosphate form the backbone

  6. Base-pairing & DNA Stability • 4 nucleotide bases in DNA • Cytosine (C) pairs with Guanine (G) • 3 hydrogen bonds • Strong-pairing • Adenine (A) pairs with Thymine (T) • 2 hydrogen bonds • Weak-pairing • Stacking forces • Van der Waals forces • Influenced by nearest neighbour sequence

  7. Base-pairing Purines Pyrimidines

  8. Oligonucleotides Short single-stranded DNA

  9. Uses for oligonucleotides • PCR, etc. • Primer pairs • Primer sets in multiplex assays • Probes • Sequence identification • Gel shift assays • Gene technology • Synthetic genes • Site-directed mutagenesis

  10. Oligonucleotide Choice • Sequence • Specificity • GC content • Target sequence location • Avoiding repeat sequences • Melting temperature • Avoid Secondary structures

  11. Specificity • Approximation of complexity (for a random sequence) • 1 base = 41 ; 2 bases = 42 ; 3 bases = 43 ; ...n bases = 4n • Biological sequences are not random! • Check the oligos with BLAST • Need to avoid complementarity with repetitive sequences in specific organism • e.g. human Alu sequences, simple repeats

  12. Unwanted Self & Primer-Primer Interactions • Primer self-complementarity • At 3’-end can result in primer-dimer formation • Internal homology : stem & loop structures • Forward & reverse primer complementarity • Primer-dimer formation between different primers ||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||

  13. Primer Length vs Purity • Most oligonucleotide synthesis reactions are only 98% efficient.  • Each time a base is added, only 98% of the oligos will receive the base. • As length increases, so does the probability that a primer will be missing a base • Critical in mutagenesis or cloning reactions.  • Purification by HPLC or PAGE is recommended in some cases. 

  14. Primer Length vs Purity

  15. Melting Temperature • Oligonucleotide Factors: • Primer length • GC content i.e. Overall Sequence • Sequence order due to stacking forces: • nearest neighbour analysis • Reaction Conditions: • Salt concentration • Primer concentration • Presence of additives in reaction; • e.g. formamide, DMSO, betaine, glycerol

  16. Hyperchromic shift & Tm ssDNA 50% denatured dsDNA Melting temperature Experimental determination of DNA melting temperature

  17. Melting Temperature vsAnnealing Temperature ssDNA Annealingtemperatures dsDNA Melting temperature

  18. Mismatched Bases Mismatched bases Bonding between neighbouring bases is weakened by the mismatch.Therefore, the melting temperature is lowered

  19. General Rules for PCR Primers Innis & Gelfand 1990 • Length : 17-28 bases • G+C content : 50-60% • GC clamp: terminal G, C, GC or CG • Primer Tm : 55° - 80°C • Avoid 3’-complementarity • Avoid internal self-complementarity • Avoid runs of 3 or more Gs or Cs near ends

  20. Steps of PCR • DENATURATION • PRIMER ANNEALING • PRIMER EXTENSION BY POLYMERASE 20 to 21 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

  21. |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| 21 to 22 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

  22. |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| 22 to 23 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

  23. DNA Denaturation ssDNA 5’ 3’ 3’ 5’ Complementary strands

  24. Primer annealing

  25. Annealing & Primer extension Primer Polymerase Template

  26. Primer Design Using computers to get primers that will work well

  27. Why use computers? • Comparison of candidate primer sequence with repeat sequences from the species of interest • Nearest-neighbour Tm calculations • Primer self-complementarity analysis • Identification of potential primer-dimer formation • Analysis of large numbers of forward and reverse primer combinations to find a pair that fit the desired criteria for target sequence, product size, primer Tm, etc.

  28. PC based software • Commercial packages: • iOligo • DNA Star • PCR Help! (free demo) • Oligo (free demo) • Primer Premier (free demo) • Free software: • PerlPrimer • Oligos • GeneTool Lite (no longer supported)

  29. Terminology Forward primer Target: sequence to be included between primers Template: (genomic DNA or cDNA) Reverse primer Amplicon: resulting PCR product

  30. ANGIS Biomanager • GCG Prime • Basic selection of oligonucleotide primers for PCR and sequencing • CodeHop • designs a pool of primers containing all possible 11- or 12-mers for the 3' degenerate core region and having the most probable nucleotide predicted for each position in the 5' non-degenerate clamp region • Primer3

  31. “Primer3” • http://frodo.wi.mit.edu/ • Primer3 picks primers for PCR reactions, according to the conditions specified by the user. • Primer3 considers things like • melting temperature • concentrations of various solutions in PCR reactions • primer bending and folding • Can also pick probes according to specified parameters • Variants: e.g. PrimerQuest, with graphic output • http://scitools.idtdna.com/Primerquest/

  32. “Exon Primer” • http://ihg.gsf.de/ihg/ExonPrimer.html • helps to design intronic primers for the PCR amplification of exons • needs a cDNA and the corresponding genomic sequence as input • can avoid primers to be positioned across SNPs, using genomic sequence where SNPs are masked by N’s in input genomic sequence

  33. “Exon Primer” Multiple Targets: gene exons SNPs Template: genomic DNA Single amplicon for small exons/introns Multiple Amplicons Overlapping amplicons for large exons

  34. “CODEHOP” • http://blocks.fhcrc.org/blocks/codehop.html • COnsensus-DEgenerate Hybrid Oligonucleotide Primers • PCR primers designed from protein multiple sequence alignments • Amino acid alignments must be in Blocks Database format • Intended for cases where the protein sequences are distant from each other and degenerate primers are needed

  35. “POLAND” • http://www.biophys.uni-duesseldorf.de/local/POLAND/poland.html • Calculates the thermal denaturation profile of double-stranded RNA, DNA or RNA/DNA-hybrids based on sequence input and parameter settings e.g. Sequence: 70 44r CGCCAGCTTGGTCCGAGCTCGGATCCACTAGCTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTACCTGG

  36. PerlPrimer • http://perlprimer.sourceforge.net/ for downloading • Free open source standalone • Runs in Windows, Linux, MacOS • Features: • Calculation of possible primer-dimers • Retrieval of genomic or cDNA sequences from Ensembl (including both sequences automatically for Q-PCR) • Ability to BLAST search primers using the NCBI server • Results can be saved or optionally exported in a tab-delimited format that is compatible with most spreadsheet applications. • ORF and CpG island detection algorithms • Ability to add cloning sequences to primers, automatically adjusted to be in-frame • Q-PCR primer design without manual intron-exon boundary entry

  37. PerlPrimer

  38. Other Resources • NCBI: http://www.ncbi.nlm.nih.gov • BLAST • Entrez • Genome Browser @ UCSC • http://genome.ucsc.edu/ • Genome Browser Human Dog Drosophila Mouse Chicken S. cerevisiae Rat Fugu Chimp C. elegans • In-Silico PCR • Blat search • SNPs

  39. Special Applications Modified Oligonucleotides & Special Primers

  40. Degenerate Primers • Mixed oligos • e.g. actgattc[gc]tgct[atc] • Nucleotides can be in unequal ratios • Increased degeneracy means concentration of the individual primers decreases • Deoxyinosine (dI) • dI at degenerate positions rather than use mixed oligos • dI base-pairs with any other base, effectively giving a four-fold degeneracy at any position in the oligo where it is present • Degeneracies obviously reduce the specificity

  41. Autosticky PCR • “dSpacer” protected tetrahydrofuran phosphoramidite • For inclusion of abasic sites in an oligo • Abasic sites cause stalling of DNA polymerases • Can therefore be used to create 5’-overhangs in PCR products; “autosticky-PCR” • Overhangs capable of annealing with restriction enzyme generated 5’-overhangs • Chemical 5’-phosphorylation recommended

  42. Real Time PCR • Considerations for primer design • Smaller amplicon = higher efficiency • amplicon ideally < 150 bp; maximum 400 bp • Amplifying gDNA or cDNA • gDNA: primers that are intron-specific • cDNA: primers spanning exon-exon boundaries of spliced transcript • Avoid a 3'-end T as this has a greater tolerance of mismatch • Primer length: 18–30 nucleotides

  43. Taqman Probes • Select the probe first and design the primers as close as possible to the probe without overlapping it • Tm should be 68°–70°C • No G on the 5´ end • Select the strand that gives the probe more C than G bases • Avoid runs of an identical nucleotide. This is especially true for guanine, where runs of four or more Gs should be avoided • Fluorophore to quencher: optimally 6-14 bases apart • Internally positioned quencher increases probe sensitivity

  44. Summary • Oligo synthesis services that design Q-PCR primers and probes and guarantee them • Many useful commercial programmes • Multiple free tools for designing primers • PerlPrimer (Desktop computer) : simple • Primer3 (Web) : highly customisable • CODEHOP (Web) : for degenerate primers • Always check your primer sequence! • Many published primers contain serious errors!

  45. The End • That link again: http://users.bigpond.net.au/albert/primers.htm

More Related