Genetics …in the news. - PowerPoint PPT Presentation

lars-barton
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Genetics …in the news. PowerPoint Presentation
Download Presentation
Genetics …in the news.

play fullscreen
1 / 21
Download Presentation
Genetics …in the news.
108 Views
Download Presentation

Genetics …in the news.

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Genetics …in the news.

  2. Mutations …are heritable changes in base sequences that modify the information content of DNA.

  3. Reverse mutations: novel mutant alleles can revert back to wild-type… a --> A+ , B --> b+ reversions Wild-type Allelestwo definitions • General: any allele existing at a frequency greater than 1% in a natural population, • Experimental Geneticist: the one allele that dictates the most commonly found phenotype in a population. • Forward mutation: any change that changes a wild-type allele to a different allele… A+ --> a recessive mutation b+ --> B dominant mutation

  4. Mutant Classifications…by their effect on DNA Substitutions

  5. Deaminating Agents Base Analogs Intercalating Agents Alkylating Agents Mutagenic Agents

  6. To Know

  7. i d Mutant Classifications…by their effect on DNA deletions and insertions 1 base? 2 base? 3 base? etc.

  8. Frameshifts

  9. translocations Mutant Classifications…by their effect on DNA inversions

  10. cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg Trinucleotide Repeat Expansions FMR1 Fragile X Mental Retardation 1 ...GCGCGGCGGTGACGGAGGCGCCGCTGCCAGGGGGCGTGCGGCAGCG... cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg > 230 ... …CTGGGCCTCGAAGCGCCCGCAGCCA

  11. Ames Testtesting for mutagenicity More mutagenic? Barbecue beef Iceberg Lettuce Cold Beer

  12. ? AAUAAA 5’ 3’ 5’ 5’ 5’ 3’ N- -C enhancer, silencer, core promoter? ? ? ? ? 3’ 5’

  13. Transposable Elements …a segment of DNA that can move to, or move a copy of itself to another locus on the same or a different chromosome (hopping DNA), …may be a single insertion sequence, or a more complex structure (transposon) consisting of two insertion sequences and one or more intervening genes.

  14. Inverted repeats. Transcribed genes. Transposable Elements

  15. normal gene, normal RNA, normal protein, transposon inserted in gene, abnormal RNA, abnormal protein, loss of function. Transposition

  16. Other genes. Transposons Two transposable elements flanking other DNA, the whole complex ‘hops’.

  17. ? ? AAUAAA 5’ 3’ 5’ 5’ 5’ 3’ N- -C ? ? ? ? 3’ 5’

  18. Assignments • Chapter 7: Problems 7.1 - 7.12, • Monday: Prokaryotic Genetics, 8.1 - 8.3s