Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
I.E.S. Suel – Fuengirola – Departamento de Ciencias Naturales iessuel/ccnn PowerPoint Presentation
Download Presentation
I.E.S. Suel – Fuengirola – Departamento de Ciencias Naturales iessuel/ccnn

I.E.S. Suel – Fuengirola – Departamento de Ciencias Naturales iessuel/ccnn

264 Views Download Presentation
Download Presentation

I.E.S. Suel – Fuengirola – Departamento de Ciencias Naturales iessuel/ccnn

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. A.D.N. Cromosoma Gregorio Mendel I.E.S. Suel – Fuengirola – Departamento de Ciencias Naturales www.iessuel.org/ccnn Genética y herencia Representación de la Primera Ley de Mendel. El material genético se reparte a las células hijas durante la división celular. El “padre” de la Genética El asesoramiento médico puede prevenir la aparición de algunas enfermedades genéticas en los bebés de una pareja. Este insecto ha sido muy utilizado en investigaciones genéticas. Drosophila melanogaster

  2. 1 La herencia. Los caracteres hereditarios Reflexiona • Es posible que tú tengas los ojos marrones y tu hermana azules, o quizás seas más bajo o más alto que ella; puede que una vaca determinada produzca más leche que su hermana… • ¿Crees que la transmisión de algunas características de los progenitores a su descendencia es una propiedad de todos los seres vivos? • Y, si es así, ¿cómo se transmiten los caracteres hereditarios?.

  3. 1 La herencia. Los caracteres hereditarios Reflexiona ¿Cómo explicas que no pueda nacer un bebé de un tomate? ¿Por qué los hermanos gemelos son físicamente idénticos? ¿Cómo explicas los parecidos dentro de una familia? ¿Por qué una loba no puede parir gatitos?

  4. 1 La herencia. Los caracteres hereditarios Reflexiona ¿Sabes qué hay que hacer para que nazcan perros y gatos de razas tan diversas?

  5. 1 La herencia. Los caracteres hereditarios ¿Sabes qué es el A.D.N.? El jurado declara a Tony King culpable del asesinato de Rocío Wanninkhof El ADN de King coincidía con el encontrado en una colilla recogida en el escenario del crimen contra Rocío.

  6. 1 La herencia. Los caracteres hereditarios ¿Sabes qué es el A.D.N.?

  7. Crean una vaca enana para que podamos consumir leche recién ordeñada. Recomiendan no guardar en la nevera al pobre animal. Prestigiosos biólogos sospechan que el campeón mundial de peleas de gallos se obtuvo haciendo trampa, por Ingeniería Genética. ¿Qué crees que puede ser el “código del genoma humano”? ¿Has oído hablar de la “Ingeniería Genética”? (la foto del gallo es falsa, se trata de un montaje) Pero… ¿has pensado alguna vez por qué un animal no crece más de un cierto tamaño?

  8. 1 La herencia. Los caracteres hereditarios Noooooo, no te descargamos de Internet, tú naciste...

  9. 1 Gregorio Mendel La herencia. Los caracteres hereditarios Todos los seres vivos tienen características que se pueden transmitir de padres a hijos. La genética es la ciencia que estudia los componentes hereditarios que producen variabilidad entre los seres vivos, esto es, la herencia. Como sabes, tanto las plantas como los animales están formados por células. En el núcleo de todas las células se encuentran los cromosomas, que son los encargados de transmitir los caracteres. Aunque no conocía el microscopio ni los cromosomas, realizó los primeros descubrimientos genéticos, fundando las bases de la Genética. Los cromosomas se ven al microscopio cuando la célula está dividiéndose Núcleo Cromatina Nucleolo Célula en reposo (sin dividirse) Célula en división

  10. Un repaso a la estructura celular La célula constituye la unidad estructural y funcional básica de los seres vivos, ya que es capaz de realizar por sí misma las tres funciones vitales: Nutrición, Relación y Reproducción. Célula eucariota Membrana celular Regula el intercambio de sustancias Citoplasma Agua y sustancias disueltas. En él se encuentran los ORGÁNULOS Dirige la actividad celular porque contiene “las instrucciones”: el ADN o material genético Núcleo

  11. Un repaso a la estructura celular Las células eucariotas están constituidas por tres estructuras básicas: la membrana plasmática, el citoplasma y el núcleo. Membrana plasmática. Es la capa exterior que aísla y protege a la célula del medio que la rodea, regulando el intercambio de sustancias con él. Citoplasma. Es una sustancia viscosa en la que se encuentran los orgánulos celulares responsables de las diferentes funciones de la célula, como la respiración celular, el almacenamiento y el transporte de proteínas, etcétera. Citoplasma Membrana Núcleo Núcleo celular. Es el orgánulo responsable de controlar las funciones celulares. En su interior se encuentra el material genético o ADN (*), que contiene toda la información relacionada con la organización y funcionamiento celulares. El ADN que está unido a proteínas recibe el nombre de cromatina y se encuentra repartido de forma difusa por todo el núcleo, constituyendo una masa de aspecto filamentoso. Al iniciarse la división celular, la cromatina adquiere una estructura definida y da lugar a los cromosomas. (*) ADN: ácido desoxirribonucleico, molécula orgánica portadora de la información genética

  12. La membrana Es una fina capa que constituye el límite de la célula, separándola del medio externo. Su función es proteger la célula regulando el intercambio de sustancias que entran y salen a través de ella. Entrada y salida de sustancias Algunas sustancias tienen “permiso” para entrar. Otras para salir. Algunas no entran ni salen, o lo harán dependiendo de las circunstancias del momento.

  13. Ya vimos en 3º de E.S.O. que el citoplasma contiene varios tipos de orgánulos, cada uno de ellos con una estructura y función determinada. Retículo Endoplasmático Membrana Citoplasma Ribosomas Núcleo Vacuola Citocentro Mitocondrias Lisosoma Aparato de Golgi Célula eucariota animal

  14. El núcleo celular Núcleo Ampliación del núcleo Célula eucariota (*) El núcleo dirige toda la actividad de la célula porque contiene las “instrucciones” o el “programa” de ésta. Esta información con las “instrucciones” se almacena en una molécula llamada ADN (ácido desoxirribonucleico), que está unida a proteínas formando una masa filamentosa llamada CROMATINA. (*) Como vimos en 3º de E.S.O., las células eucariotas son más evolucionadas, más complejas, con varios tipos de orgánulos, con el material genético envuelto por una membrana nuclear: tienen un verdadero núcleo. Son eucariotas las células de todos los seres vivos menos las bacterias.

  15. Tú comenzaste siendo una célula, luego dos, luego cuatro… 2 células 4 células 8 células ¿Cuántas células crees que tienes ahora?

  16. Células Células Músculo Esófago Células Células Capa grasa del abdomen Cartílago Glóbulos blancos Células Glóbulos rojos Células de la sangre Hueso ¡50.000 mil millones! ¡Es el número de células que tiene tu organismo!

  17. 2 Los cromosomas y los genes Los cromosomas son cadenas de ADN superenrolladas, compuestas por moléculas unidas como las cuentas de un collar. Cada cierto número de cuentas constituye un gen, es decir, un determinado trozo de ADN. Los genes portan la información que permitirá crear un nuevo organismo y la transmiten mediante un código químico. Existen genes para el tamaño, el color, la forma, etc. Cada cromosoma contiene numerosos genes.

  18. 2 Los cromosomas y los genes Un gen es un fragmento de ADN que lleva la información para un carácter hereditario. El conjunto de genes que determina todos los caracteres hereditarios de una especie recibe el nombre de genoma. Clic aquí para ver un vídeo sobre el ADN y la Genética

  19. En el ADN están impresas las instrucciones que necesita un ser vivo para nacer y reproducirse.

  20. A.D.N. Los cromosomas pueden compararse con un lápiz de memoria, un CD o cualquier otro soporte físico de almacenamiento de datos informáticos. Los datos o archivos (la información), podrían compararse con los genes. • No puede haber datos si no hay un soporte físico. • No puede haber genes si no hay ADN. Cromosoma • El ADN de los cromosomas es el soporte físico de los genes. Al igual que en un CD o lápiz de memoria caben muchos datos, en los cromosomas hay muchísima información (se calcula que hay unos 100.000 genes en la especie humana). Comparación: Archivos Genes Shakira.mp3 ……………… Gen responsable del color de ojos Bisbal.mp3 ……………… Gen responsable del color del pelo Foto001.jpg ……………... Gen responsable de la forma de la oreja

  21. En nuestra lengua, podemos escribir innumerables palabras, frases, libros… Para ello necesitamos las 28 letras del abecedario: A B C D E F G H … H O L A En el lenguaje genético, con cuatro “letras” se construyen innumerables genes ATTCCGGATCCTAGGCTATA….. Gen color ojos En el lenguaje informático, un archivo es una sucesión de ceros y unos 001010100010101011101000… Shakira.mp3 Ordenando letras construimos palabras Las cuatro “letras del abecedario genético”

  22. Si tuviésemos la información contenida en el ADN de los dinosaurios, podríamos –al menos en teoría- hacer “resucitar” a estas especies de reptiles extinguidos.

  23. Pero dejémonos ahora de dinosaurios y volvamos a los cromosomas. Los cromosomas se ven al microscopio cuando la célula entra en división Núcleo Cromatina Nucleolo Célula en reposo (sin dividirse) Célula en división Esta fotografía muestra, al microscopio, células de la epidermis de cebolla en división. Los cuerpos oscuros son los cromosomas.

  24. Condensación e individualización de la cromatina Núcleo Cromatina Nucleolo La cromatina es como un largo hilo de lana Este punto es el centrómero Cuando la célula va a comenzar la división, la cromatina se individualiza y adquiere una forma condensada parecida a un bastón. Un cromosoma es como un ovillo Cromosoma Puede transportarse mucho mejor un ovillo de lana que la misma cantidad de lana suelta. Del mismo modo, es mucho mejor para la célula repartir el material genético a las células hijas si la cromatina se ha condensado en cromosomas.

  25. Cuando la célula va a comenzar la división, el material genético produce una copia exacta de sí mismo, por lo que en vez de un filamento, contiene dos, llamados cromátidas, que están unidos por el centrómero. Cada una de las copias es una cromátida Duplicación centrómero Cromátida 1 Cromátida 2 En la división celular, el material genético (ADN) se reparte por igual entre las células hijas. Para ello es necesario que, previamente, se halla producido la duplicación de este ADN. Animación realizada con fotos reales División celular. Las células hijas necesitan heredar la información genética de la célula madre.

  26. Veamos más cosas importantes que debes saber sobre los cromosomas: En casi todas las células, los cromosomas se observan siempre en parejas. Los dos cromosomas de una pareja reciben el hombre de homólogos. Pareja de homólogos 1 Pareja de homólogos 2 • El número de parejas de homólogos es siempre el mismo en todas las células de una especie. Por ejemplo: • Los seres humanos tenemos 23 parejas (en total: 46 cromosomas) • La mosca del vinagre tiene sólo 4 parejas (en total: 8 cromosomas) Drosophila melanogaster (mosca del vinagre)

  27. Veamos más cosas importantes que debes saber sobre los cromosomas: En casi todas las células, los cromosomas se observan siempre en parejas. Los dos cromosomas de una pareja reciben el hombre de homólogos. Pareja de homólogos 1 Pareja de homólogos 2 Tipos de cromosomas Metacéntrico Submetacéntrico Acrocéntrico Es posible ordenar los cromosomas por parejas, ya que los homólogos tienen exactamente la misma forma y el mismo tamaño. Aquí puedes ver los nombres de los tipos de cromosomas según la posición que ocupa el centrómero.

  28. 23 parejas de cromosomas Cromosomas sexuales El conjunto de características de los cromosomas de la célula de una especie constituyen el CARIOTIPO. Cuando se ordenan por parejas en un gráfico, este recibe el nombre de CARIOGRAMA Cariotipo humano. En total hay 23 parejas de homólogos. Suele expresarse como 2n = 46 ( n = 23 )

  29. n n Célula huevo o cigoto 2n ¿Cómo se heredan los cromosomas? Normalmente (*), cada célula de nuestro cuerpo tiene un total de 46 cromosomas, o 23 pares. Heredamos la mitad de los cromosomas (un miembro de cada par) de nuestra madre biológica y la otra mitad (el miembro homólogo de cada par) de nuestro padre biológico. Los científicos han enumerado los pares de cromosomas de 1 a 22, habiéndole dado al par 23 el nombre de X o Y, según la estructura. Los primeros 22 pares de cromosomas se llaman "autosomas". Los cromosomas del par 23 se conocen como los "cromosomas sexuales" porque determinan si el bebé será varón o mujer. Las mujeres tienen dos cromosomas "X" y los hombres tienen un cromosoma "X" y un cromosoma "Y". La representación gráfica de los 46 cromosomas, ordenados en pares, recibe el nombre de cariotipo. El cariotipo normal de la mujer se escribe 46, XX, mientras que el cariotipo normal del hombre se escribe 46, XY. óvulo espermatozoides (*) La excepción son los gametos (espermatozoides y óvulos), que tienen la mitad (n) de cromosomas (un cromosoma de cada pareja de homólogos) 2n

  30. LA HERENCIA DEL SEXO Como ya sabemos el sexo en la especie humana está determinado por los cromosomas sexuales X e Y. Las mujeres son homogaméticas (XX) y los hombres heterogaméticos (XY). Si en el momento de la concepción se unen un óvulo X con un espermatozoide X, el zigoto dará una mujer. Si se unen un óvulo X con un espermatozoide Y, dará una hombre. ♂ Hombre ♀ Mujer XY XX X X Y XX XY (i+5)

  31. 2n 2n n n Célula huevo o cigoto 2n Las células con 2n cromosomas se dice que son DIPLOIDES Las células con n cromosomas se dice que son HAPLOIDES (del griego diplo = doble ; haplos = simple) Fíjate que debe existir un mecanismo por el cual se reduzca a la mitad el número de cromosomas para formar óvulos o espermatozoides. Después veremos que este mecanismo se llama MEIOSIS (del griego meios = mitad) Cada una de tus células es diploide (2n) desde que fuiste un cigoto. 2n

  32. 3 Reproducción celular Mediante el proceso de reproducción, las células dan lugar a nuevas células. En los organismos unicelulares, la reproducción coincide con la creación de un nuevo ser; en los pluricelulares, las nuevas células forman parte de los diferentes tejidos para sustituir a las que mueren o para crecer. Células hijas formándose En las células procariotas (*) se produce la división simple por bipartición: el ADN de la bacteria se duplica y forma dos copias idénticas. Cada copia se va a un punto de la célula y más tarde la célula se divide en dos mitades. Así se forman dos células hijas iguales, más pequeñas que la progenitora. Material genético División bacteriana. (*) Como vimos en 3º de E.S.O., hay dos tipos de células: procariotas y eucariotas. Las procariotas son más primitivas, más sencillas, con muy pocos orgánulos, con el material genético disperso en el citoplasma, no envuelto por una membrana nuclear: no tienen un verdadero núcleo. Son las bacterias.

  33. 3 Reproducción celular En las células eucariotas (*), se diferencian dos procesos en la reproducción celular: la división del núcleo y la división del citoplasma. (*) Como vimos en 3º de E.S.O., las células eucariotas son más evolucionadas, más complejas, con varios tipos de orgánulos, con el material genético envuelto por una membrana nuclear: tienen un verdadero núcleo. Son eucariotas las células de todos los seres vivos menos las bacterias.

  34. 3 Reproducción celular En las células eucariotas hay dos tipos de división celular: mitosis y meiosis. El cuerpo crece porque las células somáticas (*) se dividen por mitosis. En un adulto la mitosis hace posible la regeneración de las células muertas. Cuando una célula se divide por mitosis, las células hijas son idénticas a la célula madre. Cuando la división es por meiosis, se reduce a la mitad el número de cromosomas. 2n MITOSIS diploides 2n 2n Célula madre Células hijas n MEIOSIS n haploides n n 2n Célula madre Células hijas Por meiosis se dividen las células germinales (madres) de los espermatozoides (situadas en los testículos) y las células germinales (madres) de los óvulos (en los ovarios). Las células hijas, los gametos, son haploides (n). (*) Células somáticas: células que constituyen el organismo, excepto las sexuales.

  35. 3 Reproducción celular Observa el dibujo durante un buen rato. Se trata de una animación que, tras acabar (células hijas), vuelve a empezar (célula madre), formando un ciclo. Del mismo modo, la vida de una célula real es un ciclo. 3.1.-La mitosis Cuando los organismos crecen o reparan tejidos dañados, forman nuevas células mediante el proceso de división celular llamado mitosis. Para que pueda darse la división nuclear es necesario que se de previamente otro proceso, que es la replicación o autoduplicación del ADN. Fíjate que las dos cromátidas de un cromosoma terminan separándose y repartiéndose a las células hijas La autoduplicación del ADN ocurre al final etapa del ciclo celular llamada interfase.

  36. 3.1.-La mitosis DIVISIÓN NUCLEAR (CARIOCINESIS) La mitosis no es una reproducción en sí misma, sino que es un proceso de división nuclear que sirve para repartir las cadenas de ADN de forma que todas las células hijas que se originan tengan la MISMA INFORMACIÓN GENÉTICA que su madre y entre ellas. La mitosis es continua, sin interrupciones, relativamente rápida, que para ser estudiada se suele dividir en varias fases, que son la PROFASE, la METAFASE, la ANAFASE y la TELOFASE. Animación de la mitosis

  37. 3.1.-La mitosis PROFASE Comienza con la conversión de la CROMATINA en CROMOSOMAS (1) por un proceso de espiralización de las cadenas (igual que si tenemos un alambre largo y lo convertimos en un muelle), seguiremos teniendo lo mismo, pero de forma diferente: las dos cadenas que son completamente idénticas (ya que una se ha formado por replicación de la otra) se espiralizan juntas originando las cromátidas del cromosoma. Se duplican los centríolos (2). La membrana nuclear desaparece (3). Cuando ya ha desaparecido la membrana nuclear, los centríolos migran hacia los polos (extremos) de la célula (4), apareciendo entre los dos pares de centríolos una serie de fibras de proteína dispuestas de polo a polo que reciben el nombre en conjunto de HUSO ACROMÁTICO (5). Los cromosomas ya formados se mueven y se unen a una fibra del huso por su centrómero (un sólo cromosoma por fibra) (6), de manera que las cromátidas miran hacia los polos de la célula. Cuando se han unido se van moviendo hasta situarse en el centro de la célula. En la célula vegetal no existen centríolos y a veces no se ve el huso acromático.

  38. 3.1.-La mitosis METAFASE Es una fase breve en la que todos los cromosomas se encuentran situados en el ecuador (parte media) de la célula, formando una figura muy característica llamada PLACA ECUATORIAL (1). Tras colocarse aquí comienza la siguiente fase.

  39. 3.1.-La mitosis ANAFASE Las cromátidas se separan y se desplazan hacia los centríolos, al tiempo que van desapareciendo las fibras del huso. En este momento ya se ha repartido el material hereditario (las cadenas de ADN) de forma idéntica en dos partes.

  40. 3.1.-La mitosis TELOFASE Es como una profase al revés, los cromosomas se desespiralizan y se transforman en cromatina (2); aparece la membrana nuclear (1), quedando una célula con dos núcleos. Aquí concluye la mitosis propiamente dicha.

  41. 3.1.-La mitosis DIVISIÓN CITOPLASMÁTICA (CITOCINESIS) No es una fase de la mitosis. Es la división del citoplasma en dos partes, con la repartición aproximada de los orgánulos celulares. En las células animales se hace por estrangulación, desde fuera hacia adentro, y en las vegetales se hace por crecimiento de la pared celular desde dentro hacia afuera. El resultado final es que la célula madre se ha transformado en dos células hijas idénticas genéticamente.

  42. 3.2.-La meiosis Recuerda que ya hemos visto que: Cuando la división es por meiosis, se reduce a la mitad el número de cromosomas. n MEIOSIS n haploides n n 2n Célula madre Células hijas Por meiosis se dividen las células germinales (madres) de los espermatozoides (situadas en los testículos) y las células germinales (madres) de los óvulos (en los ovarios). Las células hijas, los gametos, son haploides (n). Debe existir un mecanismo por el cual se reduzca a la mitad el número de cromosomas para formar óvulos o espermatozoides. Este mecanismo es la MEIOSIS (del griego meios = mitad) 2n 2n n n 2n 2n

  43. 3.2.-La meiosis Tampoco es una reproducción en sí misma, sino que es un proceso de división nuclear que utiliza los mismos mecanismos que la mitosis, por lo que es bastante parecida, aunque su significado biológico es diferente ya que es reducir a la mitad el número de cromosomas para que no se duplique el número de la especie tras la fecundación (= fusión de gametos). La meiosis es en realidad una doble división (de las cuales la segunda es como una mitosis normal) que se da exclusivamente en células diploides. El proceso comienza igual que la mitosis, es decir, con una replicación previa de todas las cadenas de ADN al final de la interfase, de manera que al comenzar la división tenemos doble número de cadenas; tras la duplicación comienza la meiosis. Célula madre n n n n 2n Primera división Segunda división Como hay dos divisiones, se forman cuatro células hijas, que son haploides (n) Animación de la meiosis

  44. 3.2.-La meiosis DIVISIÓN I PROFASE I Es similar a la de mitosis en cuanto a que es una fase de preparación: - desaparece la membrana nuclear (3)- se espiralizan las cadenas de ADN, apareciendo los cromosomas (1)- se duplican los centríolos (2) y migran a los polos (4)- se forma el huso acromático (6)- cada par de cromosomas se une a una fibra del huso (5) 

  45. 3.2.-La meiosis DIVISIÓN I PROFASE I Hasta aquí sucede como en una profase mitótica normal. Las diferencias con la profase normal se dan en el comportamiento de los cromosomas, ya que éstos antes de unirse a las fibras del huso se van moviendo y se agrupan por parejas de manera que los cromosomas que son iguales (CROMOSOMAS HOMÓLOGOS) quedan formando pares unidos cromátida contra cromátida; esta unión va a permitir que se lleve a cabo el proceso más importante de la reproducción sexual ya que es el que permite que las generaciones filiales sean diferentes a las parentales, es la RECOMBINACIÓN GENÉTICA, que consiste en que las cromátidas de los cromosomas homólogos que quedan juntas se intercambian trozos de sus cadenas de ADN, apareciendo cromátidas nuevas que antes no existían, las cromátidas recombinadas, que darán lugar a la aparición de individuos adultos nuevos que tampoco existían anteriormente. Animación de la recombinación genética Una vez realizada la recombinación en todos los cromosomas cada par de homólogos se une a una fibra del huso (5), es decir, se colocan dos cromosomas por cada fibra del huso acromático, en lugar de un cromosoma por fibra como sucedía en la mitosis; luego los pares se desplazan para colocarse en el centro de la célula.

  46. 3.2.-La meiosis DIVISIÓN I METAFASE I Los pares de cromosomas homólogos se sitúan en la parte media de la célula formando la placa ecuatorial (1). ANAFASE I Se produce la separación y migración de los cromosomas homólogos, por lo que a diferencia de lo que sucedía en la mitosis, los que se desplazan son cromosomas enteros en lugar de cromátidas. Al final de la anafase I tenemos dos juegos de cromosomas separados en los polos opuestos de la célula, uno de cada par, por lo que es en esta fase cuando se reduce a la mitad el número de cromosomas.

  47. 3.2.-La meiosis DIVISIÓN I TELOFASE I Como en la telofase normal, se puede regenerar nuevamente el núcleo (1), iniciándose inmediatamente la División II CITOCINESIS I La célula binucleada divide su citoplasma en dos, quedando dos células hijas que van a entrar en la segunda división meiótica. Animación de la división I

  48. 3.2.-La meiosis DIVISIÓN II Es como una mitosis normal que se da simultáneamente en las dos células hijas; en profase II se unen cromosomas individuales a las fibras del huso y en anafase II se separan cromátidas; al final de la citocinesis II tendremos cuatro células hijas que tendrán cada una la mitad de las cadenas de ADN que tenían en la interfase; serán por tanto células haploides cuya función será la de intervenir en la fecundación, es decir, serán gametos. En las células vegetales la meiosis es similar pero con las mismas diferencias que en la mitosis normal Recuerda: Célula madre n n n n 2n Primera división Segunda división Como hay dos divisiones, se forman cuatro células hijas, que son haploides (n) Animación de la meiosis

  49. LA MEIOSIS Las células reproductoras se producen mediante un proceso llamado meiosis que reduce a la mitad el número de cromosomas. En este proceso sólo va a cada célula reproductora uno de los cromosomas de cada par de homólogos. Esta es la razón por la que los gametos son haploides en lugar de diploides. La meiosis

  50. La mitosis y la meiosis Compara con estas animaciones las semejanzas y diferencias entre mitosis y meiosis: Partimos de una célula con 3 parejas de cromosomas 1 y 2 representan los miembros de una pareja de cromosomas homólogos. Cada pareja está representada con el mismo color. Mitosis Meiosis