kurt
Uploaded by
13 SLIDES
301 VIEWS
130LIKES

Cloning Antifreeze gene from Prochlorococcus marinus str. MIT 9319

DESCRIPTION

Cloning Antifreeze gene from Prochlorococcus marinus str. MIT 9319 . Brandon Ramirez Serge Marraback. Source Organism. Prochlorococcus marinus str. MIT 9313 These bacteria belong to the photosynthetic picoplankton and are probably the most abundant photosynthetic organism on Earth.

1 / 13

Download Presentation

Cloning Antifreeze gene from Prochlorococcus marinus str. MIT 9319

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Cloning Antifreeze gene from Prochlorococcusmarinus str. MIT 9319 Brandon Ramirez Serge Marraback

  2. Source Organism • Prochlorococcusmarinus str. MIT 9313 • These bacteria belong to the photosynthetic picoplankton and are probably the most abundant photosynthetic organism on Earth. • Prokaryotes • No Introns • Currently in contact with MIT (Chisholm Laboratory) for organism

  3. Growing • ProchlorococcusMarinus-cultures have been isolated and maintained in natural seawater-based media. The compositions of which have evolved over the years • They differ in a number of ways, primarily with respect to the type and concentration of the macronutrients and metal chelators.

  4. Weplan togetmediumfrom MIT (ChisholmLaboratory)

  5. GOI: PMT1149 • Accession #: NP_894980 • GI: 33863420 • 372 bp, 124 aa • Responsible for the production of a Type I antifreeze protein

  6. Antifreeze Proteins • There are 4 known Antifreeze proteins • Type I, Type II, Type III and Type IV • Structure differs by type • The 4 known types evolved independently. • Function is the same in all types • To bind to ice crystals and inhibit growth • Has multiple repeat regions of (Threonine-alanine(or Proline)-alanine)

  7. DNA Sequence & Primers with BioBricks gaattcgcggccgcttctagatggcgtatccggaaagcca 5’ 3’ atggcgtatccggaaagccaggtggtgatgggcggcctggtgcatattccgattattattggcgtgttttgggcgctgaacaacctgaccaccggcggcagcaaagcgaaaaaagcggcggaagcgcaggcgaaacaggcggcggaagaagcggcggcgaaagcggcggcggaagcggcggcgaaacaggcggcggaacaggcggcggcgaaagcggcggcggaagcggcggcggcgaaaaaagcggcggaagcggcggcgagcgcggcgccggcggcgaccgcggcgaccccggtgagcggcgaagcggaaaccagccaggcgagcaacaacgatacccaggcgaccccggcgccggatcaggaagtgctg • No Introns (Prokaryote) and no restriction sites in code 3’ gcggcctagaccttcacgtctactagtagcggccgctgcag 5’

  8. Plan for cloning

  9. Vector & Regulator • Vector: pSB2K3 • Resistance to Kanamycin

  10. Promoter • First choice: BBa_K360041 • Minimum blue light promoter • Weak promoter • ycgF receptor is responsive to blue light, when struck with blue light it dimerizes and binds to the ycgE repressor releasing the repressor from the promoter. • Backups: • BBa_I0500 • Pbad • Inducible by L-arabanose • BBa_K258005 • Oxygen Promoter-Vitreoscilla hemoglobin(VHb) promoter in E. coli.

  11. Interface • Cut into vector at SpeI restriction enzyme site on plasmid • Suffix of plasmid ……tactagtagcggccgctgcag ……atgatcatcgccggcgacgtc • Cut at XbaI restriction enzyme on biobrick • Prefix & Suffix of biobrick gaattcgcggccgcttctaga-GENE-tactagtagcggccgctgcag gttaagcgccggcgaagatct-GENE-atgatcatcgccggcgacgtc • Ligate • ……tactaga-GENE-tactagtagcggccgctgcag • ……atgatct-GENE-atgatcatcgccggcgacgtc

  12. testing • Testing for freezing point depression • The possibility of lowering the freezing temperature of E. Coli • E. Coli begins to die around -18 Celcius (0 Farenheit) • With Antifreeze protein we will see if this point of cell death can be lowered • The gene will be tested for by SDS-PAGE • 12.06 kD

  13. References • http://www.aslo.org/lomethods/free/2007/0353.pdf • http://www.ncbi.nlm.nih.gov/protein/NP_894980 • http://www.pnas.org/content/94/8/3811.long

More Related