140 likes | 266 Views
Cloning the OOMT2 Gene in Roses. Kim Lovik Megan Hughes. Source Article. Scent evolution in C hinese roses Doi : 10.1073/pnas.0711551105. About the Gene. Orcinol O- methyltransferase 2 Catalyzes the final methylation reaction of DMT biosynthesis DMT 3,5– dimethoxytoluene
E N D
Cloning the OOMT2 Gene in Roses Kim Lovik Megan Hughes
Source Article • Scent evolution in Chinese roses • Doi: 10.1073/pnas.0711551105
About the Gene • Orcinol O-methyltransferase 2 • Catalyzes the final methylation reaction of DMT biosynthesis • DMT 3,5–dimethoxytoluene • A major component of scent of many modern rose varieties
DNA Source • OOMT2 gene is common to all rose species • Plan is to use rose petals from a common flower shop rose. • Although all parts of the rose contain the gene, the production of the chemical compounds is most prevalent in the petals.
Cloning Strategy • Amplify gene by PCR with short primers (without BioBrick extensions) • Forward primer: ExonA1_F atggaaaggctaaacag • *no spontaneous dimer formation • Reverse primer: ExonA2_R tgcaatatcccttgagtaaaactgtatc • *no spontaneous dimer formation • Forward primer: ExonB1_F aaatgagttcggatattgcatgactgg • Spontaneous hairpin dimer formation ∆G -0.56 kj/mol*k • Reverse primer: ExonB2_R tcaaggataaacctcaat • Spontaneous hairpin dimer formation ∆G - 1.16 kj/mol*k • *Two sets of primers to remove intron from bp 799-1018
5’ atggaaaggc taaacag atggaaaggc taaacagctt taaacaccttaaccaaaaatggtcaaatggagagcattccaacgagctacttcatgctcaagcccacatctggaaccacatcttcagcttcataaactccatgtccctcaaatctgcaattcaactaggtataccagatatcatcaacaaacatggccccatgactctttctgagctcacatctgcactaccaatccatccaaccaaatcccacagcgtctaccgcctcatgcgaatattggtgcactctggcttctttgctaagaaaaagctgagtaaaactgatgaggaaggttatacccttactgatgcttcccagctccttctgaaggatcatcccttaagcctaacgcccttcttaaccgccatgctcgaccctgttttgaccacaccatggaattacttgagcacttggttccaaaacgaggaccctacgccatttgacacagcacatgggatgacattttgggattacgggaaccatcagccaagtattgcccatttgttcaatgatgccatggctagcgatgctcggttggtcaccagcgtgatcatcgatgattgcaaaggagtgtttgagggattagagtcattggtcgatgttggaggtggtacaggaactgtggcaaaggctattgctgatgcattcccacatattgaatgcactgtacttgatctcccacatgtggtggctgacctgcaaggaagtaagaacttgaaatatactggaggtgacatgtttgaggcagttcctcctgcc ctatgtcaaaatgagttccctataacgt5’ gatacagttttactcaaggtaattaaatttcagatataattttatcctaaaaaagtttggatattatgtatatttcttctatatgctattctacttgtgattaaaatgcattattttaggcaactatttaaaacacaaagtaacagtcacgtctatatctaattcactgaccaatataaa 5’a aatgagttcg actctggaccaagaccaaagcacttctaatgcttatagttattttatgtcacgagcagtg gatattgcatgactgg gatattgcatgactggaacgatgaagaatgtatcaaaatacttaagcgatctagagtggcaattacaagcaaggacaagaaaggcaaggtgattatcatagatatgatgatggagaaccagaagggggatgaggaatcaattgaaacgcagctgttcttcgacatgctgatgatggccctcgtcagaggacaagaaaggaatgagaaagaatgggctaagctcttcactgatgctggttt taactccaaataggaac t 5’ cagtgactataagataactcccattttgggtttaaggtctctcattgaggtttatccttg a
Cloning Strategy • Insert the amplified gene into a pGEM-T vector via pGEM-T and pGEM-T Easy Vector Systems protocol • Ligate back together
Check Progress • The DNA product inserted in the vector will be amplified using competent E.Coli • Amplified product will be tested to check for the OOMT2 gene. • Sequencing
Removing Internal Restriction Site • One internal restriction site that would be cut by XbaI (see next slide) • Site-Directed Mutagenesis used to mutate one base pair using two new overlapping primers One primer will contain a specified base pair change, which will mutate the internal restriction site. This will create two separate DNA fragments cut near that mutated site. The overlapping primers will be used much like removing an intron, which will connect the two DNA fragments back together. Primers:
Check Progress • Amplify new DNA product after site-directed mutagenesis, add XbaI restriction enzyme to test results • Use agarose gel electrophoresis to check for proper gene length, to ensure the fragments were reconstructed.
Insertion into BioBrick Vector • Cut out gene sequence from T-vector with EcoRI and SpeI restriction enzymes • Insert into BioBrick-compatible vector with promoter • Bba_K206000-induced in the presence of L-arabinose • Bba_K094120-induced by IPTG or arabinose • Bba_K206001-induced in the presence of L-arabinose
Transformation • Transform competent E. coli with our BioBrick vector containing our gene fragment • Provide conditions for gene expression • Proper growth conditions for E. coli in the presence of arabinose for promoter • Spread E.Coli evenly on Prepared Agar Plates • Grow overnight at 37°C
Results Test • Add 3-methoxy 5-hydoxytoluene (MHT) to the E.coli culture. • MHT will be methylated by OOMT2 produced by the E.coliproducing DHT • Rose scent is produced by this chemical reaction. It is described as “tea scent” and is expected to be a noticeable fragrance when the MHT is added to the culture.