CIII protein protects CII from proteolytic degradation. - PowerPoint PPT Presentation

slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
CIII protein protects CII from proteolytic degradation. PowerPoint Presentation
Download Presentation
CIII protein protects CII from proteolytic degradation.

play fullscreen
1 / 8
CIII protein protects CII from proteolytic degradation.
107 Views
Download Presentation
kort
Download Presentation

CIII protein protects CII from proteolytic degradation.

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. CIII protein protects CII from proteolytic degradation. Growth in rich medium activates host proteases CII is degraded, l enters the lytic cycle. In poor media, CII is not degraded.  more frequently lysogenises starving cells.

  2. CII also activates 2 other promoters PRE cI PI xis int P anti-Q Int protein functions in integration of phage genome. P antiQ transcript is an anti-sense RNA that further blocks lytic gene expression.

  3. attP xis int Integrase attB

  4. int xis

  5. cI O 3 O 2 O 1 cro R R R Prophage induction results from proteolytic cleavage of cI repressor Cro protein is then synthesised. Cro binds to OR3 and blocks cI transcription. Lytic gene transcription starts from PR and PL.

  6. PL int xis On prophage induction int and xis are expressed from PL A complex of integrase and excisionase excise the phage genome.

  7. PR cI -35 -10 TTGACT GATAAT OR3 OR2 OR1 -10 -35 TTAGAT ATACAT cro PRM WEAK cI at OR2 facilitates RNA pol binding

  8. PR -35 -10 Cro TTGACT GATAAT Start point 5’ CATACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTTACCACTGGCGGTGATAATGGTTGCATGTA 3’ OR3 OR2 OR1 3’ GTATGCAATTTAGATAGTGGCGTTCCCTATTTATAGATTGTGGCACGCACAACTGATAAAAATGGTGACCGCCACTATTACCAACGTACAT 5’ TTAGAT ATAGAT -10 -35 PRM 5’ CTGATGTGCTCAGTATCACCGCCAGTGGTATTTATGTCAACACCGCCAGAGATAATTTATCACCGCAGATGGTTATCTGTAT 3’ OL1OL2OL3 3’ GACTACACGAGTCATAGTGGCGGTCACCATAAATACAGTTGTGGCGGTCTCTCTTAAATAGTGGCGTCTACCAATAGACTAT 5’ TCATAG ACAGTT -10 -35 PL