kobe
Uploaded by
32 SLIDES
811 VIEWS
340LIKES

Forensic DNA Analysis

DESCRIPTION

Forensic DNA Analysis. What is DNA profiling?. ”The use of molecular genetic methods to determine the exact genotype of a DNA sample in a way the results can basically distinguish one human being from another” The unique genotype of each sample is called a DNA profile.

1 / 32

Download Presentation

Forensic DNA Analysis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Forensic DNA Analysis

  2. What is DNA profiling? ”The use of molecular genetic methods to determine the exact genotype of a DNA sample in a way the results can basically distinguish one human being from another” The unique genotype of each sample is called a DNA profile.

  3. Milestones in Forensic DNA analysis 1985 Alec Jeffries develops RFLP 1990 PCR analysis using single locus STR begins 1992 FBI initiates STR work 1994 DNA Identification Act: provides funding for national DNA database 1995 OJ Simpson trial focuses public attention on DNA evidence 1998 FBI starts CODIS database; Swissair disaster – all remains identified using STR DNA profiling 2001 World Trade Center disaster in NYC – many remains identified using a combination of DNA profiling approaches 2004 California proposition 69: provides funding to maintain a DNA database 2004 Indian Ocean tsunami; Interpol and other world agencies use DNA profiling to identify victims

  4. Forensic DNA Analysis - News CHICAGO, Illinois (AP) -- A man who spent 25 years in prison for rape was exonerated Monday after a judge threw out his convictions because DNA evidence showed he couldn't have committed the attack. Jerry Miller smiled and the courtroom erupted into cheers after Cook County Circuit Court Judge Diane G. Cannon read the ruling that cleared him of all charges. Miller, 48, had been found guilty of rape, robbery, aggravated kidnapping and aggravated battery even though he testified he was at home watching television at the time of the 1981 attack. He was paroled in March 2006 and now works two jobs and lives with a family member in a Chicago suburb. "I want to get on with my life, start a life, have a life," Miller said after the hearing. "I'm just thankful for this day.“ The Innocence Project, a New York-based group, had persuaded prosecutors last year to conduct DNA tests on a semen sample taken from the rape victim's clothes. Those results excluded Miller as the attacker. The case is the 200th in the United States in which a person was convicted, then exonerated based on DNA evidence, the group says. The first exonerations based on DNA testing were in 1989, and in all, the 200 defendants served about 2,475 years in prison for crimes they didn't commit, according to the group's Web site. "We look at this as a learning moment," said Peter Neufeld, a co-founder of the Innocence Project and one of Miller's lawyers. "What went wrong? We have to get the answer for the future or there'll be too many Jerry Millers.“ Miller was arrested in the attack on a 44-year-old woman at a Chicago parking garage in September 1981. The attacker raped her and put her in the trunk of her car, but he ran away when two attendants approached him as he tried to leave the garage. The attendants helped authorities make a sketch and later picked Miller out of a lineup. Now that he is exonerated, Miller no longer has to register as a sex offender. Mark Ertler, deputy supervisor of the Cook County state's attorney's office DNA review unit, told the Chicago Tribune that the case was "a good example of what the DNA unit was intended to do." 7:40 p.m. EDT, April 23, 2007

  5. Forensic DNA Analysis - Chimerism Lydia Fairchild From Wikipedia, the free encyclopedia Lydia Fairchild and her children are the subjects of a documentary called The Twin Inside Me[1]. Lydia Fairchild was pregnant with her third child, when she and the father of her children, Jamie Townsend, separated. When Fairchild applied for welfare support in 2002, she was requested to provide DNA evidence that Townsend was the father of her children. While the results showed Townsend was certainly the father of the children, the DNA tests indicated that she was not their mother. This resulted in Fairchild being taken to court for fraud for claiming benefit for other people's children or taking part in a surrogacy scam. Hospital records of her prior births were disregarded. Prosecutors called for her two children to be taken into care. As time came for her to give birth to her third child, the judge ordered a witness be present at the birth. This witness was to ensure that blood samples were immediately taken from both the child and Fairchild. Two weeks later, DNA tests indicated that she was not the mother of that child either. A breakthrough came when a lawyer for the prosecution found an article[2] in the New England Journal of Medicine about a similar case that had happened in Boston, and realised that Fairchild's case might also be caused by chimerism. In 1998, 52-year old Boston teacher Karen Keegan was in need of a kidney transplant. When her three adult sons were tested for suitability as donors, it was discovered that two of them did not match her DNA to the extent that her biological children should. Later testing showed that Keegan was a chimera, a combination of two separate sets of cell lines with two separate sets of chromosomes, when a second set of DNA was found in other tissues[3]. This DNA presumably came from a different embryo than the one that gave rise to the rest of her tissues. Fairchild's prosecutors suggested this possibility to her lawyers, who arranged further testing. As in Keegan's case, DNA samples from extended members of the family were taken. The DNA for Fairchild's children matched that of her mother to the extent expected of a grandmother. They also found that while the DNA in Fairchild's skin and hair did not match her children, the DNA from a cervical smear test was different and did match. Fairchild was carrying two different sets of DNA, the defining characteristic of a chimera.

  6. 1. Evidence is collected at the crime scene: How do investigators create a DNA profile? Blood Tissue Semen Urine Hair Teeth Saliva Bone

  7. How do crime scene investigators create a DNA profile? • 2. DNA is extracted from sources at scene and from victim and suspects

  8. DNA Quantitation PCR Amplification of Multiple STR markers Sample Genotype Determination Generation of Case Report with Probability of Random Match If match occurs, comparison of DNA profile to population databases How do crime scene investigators create a DNA profile? • 3. DNA samples are processed Sample Obtained from Crime Scene or Paternity Investigation Biology DNA Extraction Technology Separation and Detection of PCR Products (STR Alleles) Genetics Comparison of Sample Genotype to Other Sample Results

  9. Where do investigators look for differences in DNA profiles? • 4. Crime Scene Investigators search in areas that are unique from individual to individual and are “anonymous” (control no known trait or function) The areas examined are Short Tandem Repeats or STR’s

  10. Example of an STR • The TH01 locus contains repeats of TCAT. • CCC TCAT TCAT TCAT TCAT TCAT TCAT AAA • This example has 6 TCAT repeats. • There are more than 20 known TH01 alleles. • Each individual inherits 1 allele from each parent.

  11. Determining genotypes for individuals using STRs • Ms. Smith’s TH01 locus for her two chromosomes is given below. • What is her genotype? • MOM’S CHROMOSOME • CCC TCAT TCAT TCAT TCAT TCAT TCAT AAA • DAD’S CHROMOSOME • CCC TCAT TCAT TCAT TCAT TCAT TCAT TCAT TCAT TCAT TCAT TCAT TCAT TCAT TCAT AAA

  12. 5’ 3’ Starting DNA Template 3’ 5’ PCR Amplifies the DNA to Create Genotype Profile Target DNA PCR

  13. Allele ladder Mother Father Child C Child D Child E To visualize PCR products investigators use gel electrophoresis TH01 alleles Child F (14) (13) (12) (11) (10) (9) (8) (7) (6) (5) (4) (3)

  14. TH01 genotype 6-3 D3S1358 genotype 16-17 FGA genotype 21-23 Discrimination increases with number of loci profiled

  15. Real STR analysis Four different fluorescent tags have been used to identify 7 amplified loci Allele ladders are indicated by arrows

  16. Suspects are included in an investigation if their DNA profile matches with genotypes found at the crime scene Suspects can be excluded if their DNA profile does not match genotypes found at the crime scene How are suspects included or excluded from an investigation?

  17. Analysis of Results:Who can’t be excluded? CS A B C D AL 15 10 AL: Allele ladder CS: Crime Scene A: Suspect A B: Suspect B C: Suspect C D: Suspect D 7 BXP007 alleles 5 4 3 2 1 5-2 7-4 5-2 7-2 10-3 genotype

  18. Today’s Lab: Forensic Simulation • Find the PCR tubes at your station. Label them ‘CS’ for Crime Scene DNA, ‘A’ for Suspect A DNA, ‘B’ for Suspect B DNA, ‘C’ for Suspect C DNA, and ‘D’ for Suspect D DNA. • Keeping the tubes on ice, add 20 μl of Master Mix + blue primers to each tube. • Keeping the tubes on ice, add 20 µl of each DNA to the appropriately labeled tube. • USE A FRESH TIP EACH TIME! • Mix and put in thermal cycler • Cycle ~3 hours

  19. PCR Reactions Heat (94oC) to denature DNA strands Cool (52oC) to anneal primers to template Warm (72oC) to activate Taq polymerase, which extends primers and replicates DNA Repeat 41 cycles

  20. Electrophorese PCR products • Add 10 ul of Orange G Loading Dye to each PCR tube and mix • Set up gel and electrophoresis equipment • Load 20 ul of CSI allele ladder to Lane 1 • Load 20 ul of your PCR reactions in lanes 2 to 6 • Electrophorese samples • Stain gel with Ethidium Bromide • Analyze results

  21. Analysis of Results:Who can’t be excluded? CS A B C D AL 15 10 AL: Allele ladder CS: Crime Scene A: Suspect A B: Suspect B C: Suspect C D: Suspect D 7 BXP007 alleles 5 4 3 2 1 5-2 7-4 5-2 7-2 10-3 genotype

  22. Part 2: D1S80, apoB1, and Col2A1 for actual fingerprints • Using specific primers, we can analyze our own hair follicle DNA!!

  23. D1S80: DNA sample collection DNA Extraction Completed

  24. D1S80: Background The D1S80 locus is located on chromosome 1, the largest human chromosome, and the repeating sequence at this locus is 16 bp in length. An example of one D1S80 sequence, including the primer sites flanking the repeats, is shown on p. 58 (Kasai et. al., J. Forensic Science 35: 1196. 1990). To date, twenty-nine different alleles of D1S80, which range in size from 200 bp to 700 bp, have been identified. Thus, 435 different allelic combinations are theoretically possible. Each of us has two copies of the D1S80 locus, one inherited from each of our parents. Approximately 86% of the population is heterozygous at this particular locus because they have inherited a different VNTR allele from each parent, as illustrated below. Following agarose gel electrophoresis, the amplified PCR products of the D1S80 locus will appear as one band in a homozygous individual or two bands in a heterozygous individual. How this great diversity is generated at the D1S80 locus among different members of a population is still unknown, but could be caused by genetic recombination or errors in DNA replication or repair. http://www.hhmi.princeton.edu/Manual/04%20HHMI%20Lab_04%20D1S80.pdf

  25. D1S80: Overview 5’ACCGGCCCCT CACGGTGCCA AGGAAACAGC CCCACCATGA GGCGCTGAGA GAAACTGGCC TCCAAACACT GCCCGCCGTC CACGGCCGGC CGGTCCTGCG TGTGAATGAC TCAGGAGCGT ATTCCCCACG CGCCAGCACT GCATTCAGAT AAGCGCTGGC TCAGT GTCAGCCCAA GGAAGA CAGACCACAG GCAAGG AGGACCACCG GAAAGG AAGACCACCG GAAAGG AAGACCACCG GAAAGG AAGACCACAG GCAAGG AGGACCACCG GAAAGG AAGACCACCG GCAAGG AGGACCACCG GCAAGG AGGACCACCA GGAAGG AGGACCACCA GCAAGG AGGACCACCA GCAAGG AGGACCACCA GGAAGG AGGACCACCA GGAAGG AGGACCACCG GCAAGG AGGACCACCA GGAAGG AGGACCACCA GGAAGG AGGACCACCG GCAAGG AGGACCACCA GGAAGG AGAACCACCA GGAAGG AGGACCACCA GGAAGG AGGACCACCA GGAAGG AGGACCACTG GCAAGG AAGACCACCG GCAAGC CTGCAAGGGG CACGTGCATC TCCAACAAGA CAAAATAAAC AAGCCAGAGA GGGCTTGTGA CCAGTGTGGC ATTTGTCAC 3’ http://www.hhmi.princeton.edu/Manual/04%20HHMI%20Lab_04%20D1S80.pdf

  26. D1S80: Summary o >80% of all populations tested are heterozygouso 28 alleles have been publishedo repeat unit is 16 nucleotides longo if zero repeat units, the PCR product would be 142 bp longo PCR products range from 430 to 814 base pairs longo 41 repeated units have been observed in the largest allele number of repeats = (bandsize – 161)/16 + 1 http://www.ncrrsepa.org/curriculum/PDF/BSEP/Bioteach/MOD4.pdf http://www.bio.davidson.edu/courses/Bio111/Bio111LabMan/Lab%2010.html

  27. Follicle PCR – Three loci today D1S80 (covered in previous slides) apoB1 (a VNTR near the apolipoprotein B gene) Col2A1 (a VNTR near a human collagen gene)

  28. Follicle PCR: apoB, Col2A1, and D1S80 apoB VNTR Locus Primers : Primer Sequence (5' to 3') Amplified Product Size Range (bp) ATGGAAACGGAGAAATTATG 570-900 CCTTCTCACTTGGCAAATAC Reference : Boerwinkle, E et al, Proc. Natl. Acad. Sci. USA, 86, 212-216, 1989 94C-1min, 62C-6min (http://www.nature.com/bmt/journal/v29/n7/full/1703410a.html) 94C-1min, 58C-2min, 72C-4min (www.springerlink.com/index/H650R18422251GJ2.pdf) Col2A1 gene VNTR Locus Primers : Primer Sequence (5' to 3') Amplified Product Size Range (bp) CCAGGTTAAGGTTGACAGCT 584-779 GTCATGAACTAGCTCTGGTG Reference : Wu, S., et al, Nucl. Acids Res. 18, 3102, 1990 94C-1min, 60C-1min, 72C-2min (www.springerlink.com/index/H650R18422251GJ2.pdf) DIS80 VNTR Locus Primers : Cat. No. Primer Sequence (5' to 3') GAAACTGGCCTCCAAACACTGCCCGCCG 427-776 (bp) GTCTTGTTGGAGATGCACGTGCCCCTTGC Reference : Budowle B., et al, Am. Journal of Human Genet, 48, 137-144, http://www.hhmi.princeton.edu/Manual/04%20HHMI%20Lab_04%20D1S80.pdf

  29. Primers: apoB, Col2A1, and D1S80 • PURPOSE • To test the apoB, Col2A1, and D1S80 (ACD) primers on acutal student DNA at CCC. • METHOD • Prepare Instagene + Protease • Prepare a solution of InstaGene matrix containing 66 µg/ml protease. • Protease is prepared at a concentration of 20 mg/ml. • A 66 µg/ml protease solution can be prepared with 3.33 ul protease per ml of InstaGene • Pipet 200 µl of InstaGene matrix with protease into each screwcap tube (one per student). • InstaGene rapidly settles; shake to mix after every 2 aliquots. • For 10 tubes, prepare add 8 ul protease to 2.5 ml InstaGene and aliquot into 10 x 200 ul samples. • Process Hair Folicle DNA • For each hair sample, label tube with initials. • Collect 2 hairs. • Select hairs that have either a noticeable sheath (a coating of epithelial cells near the base of the hair), or a good sized root (the bulb-shaped base of the hair). • Trim the hair, leaving the last ~2 cm of the base of the hair. • Place the trimmed hairs into the screwcap tube with your initials. • Place your tube in the foam micro test-tube holder and incubate at 56°C for 5 minutes. • Shake or vortex gently. • Place tube back in the 56°C water bath for the remaining 5 minutes. • Remove the tubes, gently shake or vortex, and place them in a boiling water bath (100°C) for 5 minutes. • Remove the tubes from the boiling water bath and shake or vortex the contents to resuspend. • Store samples at 4C without centrifugation. • Prepare PCR Mastermix • Use Bio-Rad PCR Mastermix with 300 nM primers. • Primers need to be added such that 1ul primer is in each 25ul PCR reaction. • Three primer pairs: A, C, D. • Calculate total amount of mastermix for each. • Vortex mastermix thoroughly • Experimental Design • 8 individuals + NTC = 9 “samples” • 3 primer pairs per sample • No replication (??) • 8 x 3 = 24 PCR reactions total. • Prepare PCR Reactions • Use appropriate strip tubes and caps for the instrument. • Centrifuge DNA samples in instagene tubes for 5 min at full speed. • Set up the PCR reactions in each tube: • 12.5 ul Mastermix (A, C, or D) • 11.5 ul Sterile Distilled Water • 1.0 ul DNA sample • Mix thoroughly being careful not to introduce bubbles. • Run PCR reactions • Cycling protocol: • 95C 3 min • 95C 1 min • 57C 1 min • 72C 2 min • Repeat 40X

  30. Follicle PCR: apoB, Col2A1, and D1S80 Gel Analysis of Results Each person: 3 PCR reactions (A, C, and D) 7 students + 1 instructor + NTC = 9 sets Run all reactions on single gel.

  31. Bio-Rad Crime Scene Kit Gel Analysis of Results Each workgroup: CS, suspect A,B,C,D, and Allele Ladder. Can run on multiple gels.

  32. Forensic DNA Analysis

More Related