forensic dna analysis part i l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Forensic DNA Analysis (Part I) PowerPoint Presentation
Download Presentation
Forensic DNA Analysis (Part I)

Loading in 2 Seconds...

play fullscreen
1 / 30

Forensic DNA Analysis (Part I) - PowerPoint PPT Presentation


  • 254 Views
  • Uploaded on

Forensic DNA Analysis (Part I). Summary. What is DNA?. Where is DNA found in the body?. How does DNA differ among individuals?. Forensic DNA Analysis. DNA and Statistics. What is DNA?. What is DNA?. What does DNA stand for?. D eoxyribose N ucleic A cid or Deoxyribonucleic Acid.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Forensic DNA Analysis (Part I)' - illias


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
summary
Summary
  • What is DNA?
  • Where is DNA found in the body?
  • How does DNA differ among individuals?
  • Forensic DNA Analysis
  • DNA and Statistics
what is dna4
What is DNA?

What does DNA stand for?

Deoxyribose Nucleic Acid or Deoxyribonucleic Acid

What does DNA do?

  • DNA contains genetic information.
  • DNA codes for the proteins our bodies make that are necessary for survival.
what is dna5
What is DNA?

DNA is a code for making proteins.

AGC TAG CTT ATA CTC TAT CTC TTT

Amino

Acid

Amino

Acid

Amino

Acid

Amino

Acid

Amino

Acid

Amino

Acid

The order of amino acids determines what type of protein is made.

what is dna6
What is DNA?

Some common proteins are:

  • Hemoglobin - carries oxygen from lungs to cells
  • Insulin - regulates metabolism
  • Many types of enzymes - catalyze reactions in the body, such as the breakdown of sugar for energy

DNA also determines how much of these proteins each cell makes.

what is dna7
What is DNA?

What does DNA look like?

Double Helix

Like a Twisted Ladder

slide8

What is DNA?

What does DNA look like?

Sugar Phosphate

Backbone

(Sides of Ladder)

Nitrogenous

Base

(Rungs of Ladder)

slide9

What is DNA?

The DNA ladder is made up of building blocks called nucleotides.

What is a nucleotide?

Adenine

Cytosine

Guanine

Thymine

Phosphate Group

Base

Deoxyribose sugar

the 4 bases
The 4 Bases

What is DNA?

A

Adenine

C

Cytosine

T

Thymine

G

Guanine

the 4 bases12

What is DNA?

The 4 Bases

The bases pair up to form the rungs of the ladder.

A pairs with T

G pairs with C

slide13

What is DNA?

DNA is written as the sequence of these bases:

AAGTCGATCGATCATCGATCATACGT

  • Only one side of the ladder is written.
  • In humans, there are three billion (3,000,000,000) base pairs (letters) in the DNA within each cell.
slide14

What is DNA?

Among humans, most of the 3 billion bases in the DNA sequence are exactly the same.

  • Our Human DNA is 99.8% similar to each other, but the 0.2% difference is more than enough to distinguish us from one another.
  • Human DNA is even 98% similar to chimpanzees.
  • NO TWO PEOPLE HAVE IDENTICAL DNA*

*except identical twins

slide15

What is DNA?

Stupid Facts:

  • If two different people started reciting their individual genetic code at a rate of one letter per second, it would take almost eight and a half minutes before they reached a difference.
  • If unwound and tied together, the strands of DNA in one cell would stretch almost six feet but would be only 50 trillionths of an inch wide.
  • If all the DNA in your body was put end to end, it would reach to the sun and back over 600 times (100 trillion times six feet divided by 92 million miles).
where is dna17
Where is DNA?

DNA is found in the cells in our body.

Nucleus

(Brain of the cell)

Mitochondria

(more later)

slide18
K-Fed sez:

Quiz on Monday.

slide19

Where is DNA?

All types of cells in our body contain a copy of the same DNA.*

Some cells important to forensic science are:

White Blood Cell

*Sperm Cell

Cheek Cell

slide20

Where is DNA?

DNA in the nucleus is packaged into Chromosomes.

slide21

Where is DNA?

Chromosomes

come in pairs

(one from Mother)

(one from Father)

There are 46 chromosomes in each cell.

(23 pairs)

slide22

Where is DNA?

What are sources of DNA at a crime scene?

DNA can be recovered from any substance that contains cells.

  • Blood
  • Semen
  • Saliva
  • Tissue
  • Bone
  • Teeth
  • Hair
  • Maggot Crops
maggot crop
Maggot Crop

Where is DNA?

slide25

How does DNA differ among humans?

DNA is a sequence of 4 possible letters

A

G

C

T

Of the 3 billion letters, 99.8% of the sequence in all humans is identical.

There are several ways the sequence can be different.

slide26

How does DNA differ among humans?

  • One of the bases (letters) can be different.

Person 1AGCTAGATCGTTATTCCGAG

Person 2AGCTAGATCGTCATTCCGAG

slide27

How does DNA differ among humans?

Bases (letters) can be added or removed.

Person 1AGCTAGATCGTTATTCCGAG

Person 2AGCTAGATCGTATTCCGAG

Person 3AGCTAGATCGTTTATTCCGAG

Person 4AGCTCCGAG

slide28

How does DNA differ among humans?

Bases (letters) can be added or removed.

Person 1AGCTAGATCGTTATTCCGAG

Person 2AGCTAGATCGTATTCCGAG

Person 3AGCTAGATCGTTTATTCCGAG

Person 4AGCTCCGAG

slide29

How does DNA differ among humans?

Regions of DNA can be repeated a different # of times.

Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..

slide30

How does DNA differ among humans?

Regions of DNA can be repeated a different # of times.

Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..

1 2 3 4 5 6

Person 2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT..

1 2 3 4 5

Person 3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT..

1 2 3 4 5 6 7