judith
Uploaded by
22 SLIDES
415 VIEWS
220LIKES

Introduction: DNA REPLICATION

DESCRIPTION

Why is DNA called a nucleic acid?. Introduction: DNA REPLICATION. ________ Chromosomes in the original cell ________ Chromosomes after DNA replication Two cells; each with _______ Chromosomes. DNA Replication makes identical copes of the DNA in the nucleus.

1 / 22

Download Presentation

Introduction: DNA REPLICATION

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Why is DNA called a nucleic acid? Introduction: DNA REPLICATION ________ Chromosomes in the original cell ________ Chromosomes after DNA replication Two cells; each with _______ Chromosomes DNA Replication makes identical copes of the DNA in the nucleus Mitosis: The division of the DNA in the nucleus Cytokinesis: The division of the cytoplasm

  2. Nucleotides:The Building Blocks of DNA DNA and RNA are Nucleic Acids. They are composed of nucleotides Base 5 Carbon Sugar _______ _____

  3. Two nucleotides • Bases • A = Adenine • T = Thymine • G = Guanine • C = Cytosine Base Sugar Phosphate

  4. Purines Pyrimidines The Bases C T G A ____ Hydrogen Bonds ____ Hydrogen Bonds ____ Hydrogen Bonds ____ Hydrogen Bonds

  5. DNA Replication New Strand New Strand Original Strand Template Template GC TA AT GC CG TA C A T C G A G T A G C T • DNA Replication is Semi conservative. What does this mean?

  6. DNA Replication New Strand New Strand Original Strand Template Template GC TA AT GC CG TA G T A G C T C A T C G A G T A G C T C A T C G A ½ Old ½ New • DNA Replication is Semiconservative. What does this mean?

  7. The Enzyme ________________ is Required for DNA Replication

  8. The Bases In Nucleic Acids: DNA and RNA Only in _____ Only in _____

  9. DNA is _________ stranded The 5C sugar in DNA is ________________ The 4 bases found in DNA are: ____________ ____________ ____________ ____________ RNA is __________ stranded The 5C sugar in RNA is ________________ The 4 bases found in RNA are: ____________ ____________ ____________ ____________ DNA Versus RNA

  10. Protein Synthesis Transcription Translation • DNA RNA Protein

  11. Review: Proteins • Proteins are composed of? • The primary structure of a protein is its? • The site of protein synthesis it the?

  12. The RNA Dictionary

  13. The template codes for the RNA strand This strand does not code for RNA Sample Problem DNA: RNA: Protein TAC AAA CTA CCT ATA ACT ATA ____ ____ ____ ____ ___ ____ ____ RNA Polymerase RNA Polymerase ____ ____ ____ ____ ___ ____ ____ ____ ____ ____ ____ ___ ____ ____ *Note: The DNA template is the strand that codes for the RNA

  14. Sample Problem DNA: RNA: Protein TAC AAA CTA CCT ATA ACT ATA ATG TTT GAT GGA TAT TGA TAT *The template The other half RNA Polymerase AUG UUU GAU GGA UAU UGA UAU Met Phe Asp Gly Tyr *Note: The DNA template is the strand that codes for the RNA

  15. ATGTTTGGGTTAATTGCTTGCTTCCGGACTTAA Complementary DNA Strand DNA Template for RNA Synthesis TACAAACCCAATTAACGAACGAAGGCCTGAATT Transcription AUGUUUGGGUUAAUUGCUUGCUUCCGGACUUAA Unprocessed RNA in the nucleus Remove Introns (Represented by bold bases) and splice Exons together before RNA leaves the nucleus Processed RNA with Introns removed Translation: Show the amino acid sequence of the protein

  16. Transfer RNA Amino acid attachment site G C U C G A Anticodon Codon on mRNA

  17. DNA Template DNA: Sample Problem TAC AAA The other strand of the DNA molecule ATG TTT mRNA: AUG UUU GAU AAG CCA UAA • Finish the DNA the made the given RNA • Finish drawing the tRNA’s for the codons indicated with red arrows • Show the primary structure of the protein synthesized with the given • mRNA

  18. Sample Problem DNA: TAC AAA CTA TTC GGT ATT ATG TTT GAT AAG CCA TAA Met Pro U A C G G U mRNA: AUG UUU GAU AAG CCA UAA The Protein Met Phe Asp Lys Pro

  19. Sample Problem DNA Template DNA: TAC AAA CTA TTC GGT ATT The other strand of the DNA molecule ATG TTT GAG AAG GGA TAA MET PRO U A C G G U mRNA: AUG UUU GAU AAG CCA UAA • Finish the DNA the made the given RNA • Finish drawing the tRNA’s for the codons indicated with red arrows • Show the primary structure of the protein synthesized with the given • mRNA Methionine – Phenylananine - Aspartic acid - Lysine - Proline

  20. Mutations • Carcinogens • For mutations to be passed to your offspring they must occur in what types of cells? • Examples:______________________________ Somatic Cells Versus Germ-line Cells • Carcinogens typically affect what types of cells?___________________

  21. Sickle Cell Anemoa

  22. Summary • The genetic code is universal • Mutations can be harmful • Mutations are a source of genetic variability • The genetic code is a triplet code. Three bases code for one amino acid • Substances that cause mutations are called mutagenic agents. Many mutagenic agents are also carcinogenic.

More Related