sequenza struttura funzione n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Sequenza-struttura-funzione PowerPoint Presentation
Download Presentation
Sequenza-struttura-funzione

Loading in 2 Seconds...

play fullscreen
1 / 31

Sequenza-struttura-funzione - PowerPoint PPT Presentation


  • 181 Views
  • Uploaded on

Sequenza-struttura-funzione. G. P. Y. W. I. V. R. T. A. C. D. Varietà di strutture e funzioni. S. F. Q. L. E. diverse combinazioni dei 20 aa. K. N. H. M. ASSOCIARE A CIASCUNA PROTEINA DI CUI CONOSCIAMO LA SEQUENZA UNA O PIU’ SPECIFICHE FUNZIONI A LIVELLO MOLECOLARE.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Sequenza-struttura-funzione' - jesse-bush


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
sequenza struttura funzione

Sequenza-struttura-funzione

G

P

Y

W

I

V

R

T

A

C

D

Varietà di strutture e funzioni

S

F

Q

L

E

diverse combinazioni dei 20 aa

K

N

H

M

ASSOCIARE A CIASCUNA PROTEINA DI CUI CONOSCIAMO LA SEQUENZA UNA O PIU’ SPECIFICHE FUNZIONI A LIVELLO MOLECOLARE

codice strutturale

ESPERIMENTO DI ANFINSEN

Codice strutturale

NELLA SEQUENZA PRIMARIA E’ SCRITTA LA STRUTTURA DI UNA PROTEINA

  • PROTEINE CON SEQ. PRIMARIE SIMILI TENDONO AD AVERE STRUTTURE 3D SIMILI
  • CONFRONTO TRA GENOMI → i geni essenziali (ciclo cell, sviluppo embrionale, signalling) soggetti a poca variabilità
slide3

Omologia, Identità, Similarità

  • Similarità –termine generico che indica una somiglianza che può essere dovuta a omologia, ma anche alla convergenza evolutiva. E’ un parametro quantitativo (posso quantificarla in %).
  • Omologia – implica un’origine evolutiva comune e spesso anche similarità. E’ un parametro qualitativo.
  • Prima di Darwin l’omologia era definita morfologicamente
  • Con la genetica si sa che è dovuta a geni (antenati) comuni
  • Due sequenze sono omologhe se sono simili e hanno un antenato in comune
  • Se due sequenze sono omologhe la loro struttura 3D sarà conservata
slide4

L’esistenza di similarità in brevi tratti di sequenze può essere casuale

  • Similarità sufficientemente estesa implicano un’omologia (anche se non abbiamo una prova diretta di un comune antenato)
  • Di conseguenza è possibile misurare il grado di significatività della similarità
  • OMOLOGIA OMOPLASIA

Similarità dovuta ad evoluzione dallo stesso antenato comune

Similarità dovuta a convergenza evolutiva – derivano da linee diverse in seguito ad es. a una pressione selettiva simile

ortologhi paraloghi

Mediante confronti di geni simili tra genomi diversi, e di geni simili dello stesso genoma, si può stabilire se due geni sono ortologhi o paraloghi, e da qui ricostruire la probabile storia evolutiva

Ortologhi/Paraloghi

Proteine o geni omologhi possono appartenere alla stessa specie o a specie diverse e possono avere origine in seguito a eventi di Speciazione/Duplicazione

ortologhi paraloghi1

Si può ipotizzare che i vari geni “simili” tra loro che troviamo nelle diverse specie, lo siano perché “parenti”, ovvero discendenti dallo stesso/i gene/i in specie antenate (speciazione) o nella stessa specie (duplicazione)

Due sequenze (sia DNA, sia RNA, sia proteine) per cui possiamo fare questa ipotesi – basandoci sulla loro similarità – sono dette sequenze omologhe

Ortologhi/Paraloghi

che cosa diversifica nel tempo due sequenze omologhe
Che cosa diversifica nel tempo due sequenze omologhe?
  • I 3meccanismi più comuni attraverso i quali le sequenze mutano nel corso dell’evoluzione sono:
  • Sostituzione
  • Delezione
  • Inserzione

Inserzione e delezione sono una l’opposto dell’altra e vengono indicate con il termine indels

slide8

Sugar

Suiker

Sucre

Zucker

Zuckre

Sokker

Zucchero

Açucar

Azucar

Sakari

Sukkar

Europa, circa 700 dC

l evoluzione delle parole
L’evoluzionedelle parole
  • Tutte le parole dellelinguemodernecheindicano lo “zucchero” discendonodaunaparolaantenatacomune
  • Tuttedallastessa (“sukkar” - parolausatadagliarabi), alcunedaun’antenatapiùvicinanel tempo (“zuckre” in Francia)
l evoluzione molecolare
L’evoluzione molecolare
  • Ipotesi: tutte le specie esistentidiscendonoda specie “antenate”
  • Nelcorsodell’evoluzione, dauna specie possononascereuna o più specie diverse (speciazione)
  • Allora, dovremmoessere in gradoditrovare “tracce” dell’evoluzione... nelDNA!
  • Se una specie discendedaun’altra, allorailsuo DNA è simile a quellodella specie “antenata”, con - ovviamente - dellevariazioni
  • Più la speciazione è vicinanel tempo, piùil DNA (in sequenza) è “simile”
l evoluzione delle parole1
L’evoluzione delle parole
  • Immaginiamodi non conoscere le parole “antenate” dellozucchero, e didovercichiedere se due parole moderne in due linguedifferentisono “simili” traloro

SUGAR

SUGR

SUCR

SUCRE

allineamento
Allineamento
  • L’”allineamento” è un modo di rappresentare schematicamente i legami evolutivi tra due o più parole (o sequenze), indicando sostituzioni, inserzioni e delezioni

S U G A R -

S U C - R E

Inserzioni

(delezioni)

Sostituzione

(mutazione)

allineamento multiplo

S U G - A R -

S U C – - R E

Z U C K E R -

S O K K E R -

A Z U C - A R -

S A K - A R I

A ç U C - A R -

--------------------

- S U C(K)A R -

Allineamento (multiplo)
slide16

SSH_UOMO -MLLLARCLLLVLVSSLLVCSGLACGPGRGFGKRRHPKKLTPLAYKQFIPNVAEKTLGAS

SSH_TOPO MLLLLARCFLVILASSLLVCPGLACGPGRGFGKRRHPKKLTPLAYKQFIPNVAEKTLGAS

:******:*::*.******.***************************************

SSH_UOMO GRYEGKISRNSERFKELTPNYNPDIIFKDEENTGADRLMTQRCKDKLNALAISVMNQWPG

SSH_TOPO GRYEGKITRNSERFKELTPNYNPDIIFKDEENTGADRLMTQRCKDKLNALAISVMNQWPG

*******:****************************************************

SSH_UOMO VKLRVTEGWDEDGHHSEESLHYEGRAVDITTSDRDRSKYGMLARLAVEAGFDWVYYESKA

SSH_TOPO VKLRVTEGWDEDGHHSEESLHYEGRAVDITTSDRDRSKYGMLARLAVEAGFDWVYYESKA

************************************************************

SSH_UOMO HIHCSVKAENSVAAKSGGCFPGSATVHLEQGGTKLVKDLSPGDRVLAADDQGRLLYSDFL

SSH_TOPO HIHCSVKAENSVAAKSGGCFPGSATVHLEQGGTKLVKDLRPGDRVLAADDQGRLLYSDFL

*************************************** ********************

SSH_UOMO TFLDRDDGAKKVFYVIETREPRERLLLTAAHLLFVAPHNDSATGEPEASSGSGPPSGGAL

SSH_TOPO TFLDRDEGAKKVFYVIETLEPRERLLLTAAHLLFVAPHND-----------SGPTPG---

******:*********** ********************* ***..*

SSH_UOMO GPRALFASRVRPGQRVYVVAERDGDRRLLPAAVHSVTLSEEAAGAYAPLTAQGTILINRV

SSH_TOPO -PSALFASRVRPGQRVYVVAERGGDRRLLPAAVHSVTLREEEAGAYAPLTAHGTILINRV

* *******************.*************** ** *********:********

SSH_UOMO LASCYAVIEEHSWAHRAFAPFRLAHALLAALAPARTDRGGDSGGGDRGGGGGRVALTAPG

SSH_TOPO LASCYAVIEEHSWAHRAFAPFRLAHALLAALAPARTD----------GGGGGSIP-AAQS

************************************* ***** :. :* .

SSH_UOMO AADAPGAGATAGIHWYSQLLYQIGTWLLDSEALHPLGMAVKSS

SSH_TOPO ATEARGAEPTAGIHWYSQLLYHIGTWLLDSETMHPLGMAVKSS

*::* ** .************:*********::**********

slide17

ALLINEAMENTO DI SEQUENZE

A COPPIE

AGTTTGAATGTTTTGTGTGAAAGGAGTATACCATGAGATGAGATGACCACCAATCATTTC

||||||||||||||||||| |||||||| ||| | |||||| |||||||||||||||||

AGTTTGAATGTTTTGTGTGTGAGGAGTATTCCAAGGGATGAGTTGACCACCAATCATTTC

MULTIPLO

KFKHHLKEHLRIHSGEKPFECPNCKKRFSHSGSYSSHMSSKKCISLILVNGRNRALLKTl

KYKHHLKEHLRIHSGEKPYECPNCKKRFSHSGSYSSHISSKKCIGLISVNGRMRNNIKT-

KFKHHLKEHVRIHSGEKPFGCDNCGKRFSHSGSFSSHMTSKKCISMGLKLNNNRALLKRl

KFKHHLKEHIRIHSGEKPFECQQCHKRFSHSGSYSSHMSSKKCV----------------

KYKHHLKEHLRIHSGEKPYECPNCKKRFSHSGSYSSHISSKKCISLIPVNGRPRTGLKTs

slide18

Allineamento GLOBALE o LOCALE

GLOBALE considera la similarita’ tra due sequenze in tutta la loro lunghezza (da N- a C-terminale)

LOCALE considera solo specifiche REGIONI simili tra alcune parti delle sequenze in analisi (solo regioni a ↑ densità di similarità generando più sub-allineamenti)

Global alignment

LTGARDWEDIPLWTDWDIEQESDFKTRAFGTANCHK ||.  | |  |  .|     .|  |||| | ||  TGIPLWTDWDLEQESDNSCNTDHYTREWGTMNAHKAG

Localalignment

   LTGARDWEDIPLWTDWDIEQESDFKTRAFGTANCHK             ||||||||.||||            TGIPLWTDWDLEQESDNSCNTDHYTREWGTMNAHK

allineamenti di sequenza
ALLINEAMENTI DI SEQUENZA
  • Per confrontare delle sequenze queste devono essere allineate
  • ALLINEAMENTO: procedura per confrontare 2 o più sequenze residuo per residuo in modo da massimizzare la similarità tra esse e ridurre il numero di operazioni da effettuare per convertirle l’una nell’altra. E’ volto a stabilire una relazione biunivoca tra le coppie di residui delle sequenze considerate.
  • L’allineamento di sequenze è strumento indispensabile per:
  • CONFRONTO tra due sequenze;
  • RICERCA DI SEQ SIMILI a una in esame NELLE BANCHE DATI;
  • Determinazione di PATTERN e DOMINI CONSERVATI;
  • PREDIZIONE DI STRUTTURA 3D;
  • Stimare L’APPARTENENZA a UN CERTO FOLD;
  • COSTRUIRE UN ALBERO FILOGENETICO:
  • PREDIZIONE DI STRUTTURA SECONDARIA
allineamento di sequenza
ALLINEAMENTO DI SEQUENZA
  • PER ESEGUIRE UN ALLINEAMENTO DI SEQUENZA SONO NECESSARI ESSENZIALMENTE 3 STRUMENTI:
  • Avere a disposizione unaMATRICE DI SOSTITUZIONE. La matrice definisce la il GRADO di SIMILARITA’ tra amminoacidi;
  • Avere a disposizione unALGORITMO DI ALLINEAMENTO cercando di massimizzare il punteggio dato dalla matrice e valutando quanti gap (interruzioni) inserire;
  • Avere a disposizione per evitare allineamenti senza senso una PENALITA’ per l’introduzione dei GAP.

I GAP riflettono inserzioni/delezioni avvenute durante l’evoluzione

LLTTVRNN LLTTVRNN

LLVRNN LL--VRNN

similarit e distanza
Similarità e distanza

Esistono due modi per misurare il grado di omologia tra due sequenze:

  • Calcolare la similarità contando i match
  • Calcolare la distanza contando mismatche indels

Similarità elevata ↔ bassa distanza

Due sequenze identiche hanno una distanza pari a zero

similarita di sequenza
SIMILARITA’ DI SEQUENZA
  • Nel punteggio di similarità di sequenza si tiene conto del fatto che gli amminoacidi a confronto in ogni posizione siano simili, differenti o identici e di una penalità per i gap.
  • PER DEFINIRE LA SIMILARITA’ TRA LE DUE SEQUENZE SI USANO MATRICI BASATE SU PRESUPPOSTI DIVERSI:
  • identità/non identità;
  • Caratteristiche chimico-fisiche degli aa;
  • Basate sul codice genetico: valutare quante mutazioni fare in una tripletta per passare da un aa a un altro. (se ad es. si cambia un solo nucleotide la sostituzione la sostituzione sarà meno penalizzata perché si tratta di evento probabile nel corso dell’evoluzione)
  • Basate sucriteri evolutiviestrapolati da confronto di sequenze di proteine omologhe (MATRICI BLOSUM E PAM)

2 penalità per i gap (apertura (fisso), estensione (lunghezza dipendente))

penalizzazioni degli indels
Penalizzazioni degli indels
  • Generalmente si usano funzioni del tipo “lineare”

wx = gx

  • o, più frequentemente, di tipo “affine”

wx = g + rx

oppure

wx = g + r(x—1)

dove g è il punteggio di penalizzazione per l’apertura, r per l’elongazione e x la lunghezza dell’indel

matrici di sostituzione
Matrici di sostituzione
  • Le matrici di sostituzione tengono conto dei criteri di similarità tra aminoacidi
  • Comprendono 210 valori:
  • 20 (sulla diagonale) relativi al punteggio dell’appaiamento di ciascun aminoacido con se stesso
  • 190 relativi a tutte le possibili sostituzioni aminoacidiche
  • I 190 valori sono riportati anche nella loro parte speculare in modo che queste matrici hanno un formato 20 x 20 valori
  • Le matrici di sostituzione più semplici considerano solo il criterio di identità e sono costituite da valori 0 o 1
  • Altre matrici considerano la similarità chimica tra gli aminoacidi o il numero minimo di mutazioni per passare da un codon all’altro e attribuiscono un punteggio alle diverse sostituzioni
similarit chimico fisica
Similarità chimico-fisica

Gli aminoacidi possono essere raggruppati in base alle caratteristiche fisico-chimiche delle loro catene laterali. Su questa base un aminoacido può essere definito simile ad un altro

R K

basici

I V F L

idrofobici

G A

poco ingombro sterico

R K H D E

carichi

R K N Q

polari

similarit definita da criteri genetici
Similarità definita da criteri “genetici”
  • Quandosostituisco un nucleotide all’internodiunaregionecodificante, l’effettodipendedallasuaposizioneall’interno del codone

CUU  (Leu/L)LeucineCUC (Leu/L)LeucineCUA (Leu/L)LeucineCUG (Leu/L)Leucine

In questocaso, cambiandoilterzo nucleotide, non cambia nulla (mutazioni “silenti”)

AUU (Ile/I) IsoleucineAUC(Ile/I) IsoleucineAUA (Ile/I) IsoleucineAUG (Met/M) Methionine, Start

In questocaso, cambiandoil primo nucleotide, ottengoamminoacidi non troppodifferentidallaleucina... ilcodicegeneticosembraessere “robusto”, ma..

mutazioni deleterie
Mutazionideleterie

V

E

La mutazione di un nucleotide nel sesto codone dell’emoglobina-beta

(una delle sequenze che vanno a costituire l’emoglobina), causa la

sostituzione dell’amminoacido codificato, problemi nella struttura dell’

emoglobina stessa, e il cambiamento di forma dei globuli rossi, risultando

nell’anemia falciforme

quale matrice pam conviene utilizzare
Quale matrice PAM conviene utilizzare?
  • In generale per due sequenze filogeneticamente vicine è meglio utilizzare una matrice PAM a basso indice e viceversa
  • In assenza di informazioni si utilizzano PAM40, PAM120 e PAM 250
  • PAM250 individua similarità del 20%
  • PAM120 individua similarità del 40%
  • PAM80 individua similarità del 50%
  • PAM60 individua similarità del 60%
slide30

L’utilizzo della matrice di similarita’ appropriata per ciascuna analisi e’ cruciale per avere buoni risultati.Infatti relazioni importanti da un punto di vista biologico possono essere indicate da anche molto debole similarità.

Sequenze

poco divergenti   molto divergenti

BLOSUM80 BLOSUM62BLOSUM45

PAM1 PAM120PAM250

confronto tra matrici pam e blosum
Confronto tra matrici PAM e BLOSUM
  • Le matrici PAM sono basate su un modello evolutivo
  • Le matrici BLOSUM sono basate su famiglie di proteine
  • Le matrici PAM sono basate su un allineamento globale
  • Le matrici BLOSUM sono basate su un allineamento locale
  • Le matrici PAM sono utili per studi evolutivi sulle proteine
  • Le matrici BLOSUM sono fatte per individuare le regioni conservate