Bioinformatica:
Download
1 / 19

- PowerPoint PPT Presentation


  • 222 Views
  • Updated On :

Bioinformatica: Leven in de computer. Inleidende les. Binnenkort is er een computerpracticum van Nijmeegse student(en) over bioinformatica . Deze les is noodzakelijk om voorbereid te worden in de bioinformatica. Inhoud van deze les: Opfrissen moleculaire kennis

Related searches for

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about '' - jerzy


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Slide1 l.jpg

Bioinformatica:

Leven in de computer


Inleidende les l.jpg
Inleidende les

Binnenkort is ereencomputerpracticum van Nijmeegse student(en) over bioinformatica.

Deze les is noodzakelijkomvoorbereid te worden in de bioinformatica.

Inhoud van deze les:

  • Opfrissenmoleculairekennis

  • Eenaantalvoorbeelden van de bioinformatica in de praktijk.

    Benodigdheden:

  • Pen of potlood

  • Antwoordblad -inleidende les-

  • BINAS of BioData


Inzoomen van organisme naar molecuul l.jpg
InzoomenVan organisme naar molecuul

De vorm en functie van eiwitten zijn verantwoordelijk voor de functie van organellen en cellen

De cellen bepalen hoe het weefsel werkt, hoe het orgaan functioneert en uiteindelijk hoe het hele organisme leeft.

DNA is het bouwplan voor een eiwit

In (bijna) iedere cel zit DNA



Aminozuren en eiwitten l.jpg
Aminozuren en eiwitten

Pak je antwoordblad erbij!

DNA

TACGCCATACGACGGACCGACGACCCA

……….

transcriptie

RNA

AUGCGGUAUGCUGCCUGGCUGGGUUGA

……….

translatie

aminozuren

Methionine (start), arginine, tyrosine, alanine, alanine, tryptofaan, leucine, glycine

M R Y A A W L G

Er bestaat geen tRNA die past op UGA, de ketting aminozuren wordt hierdoor onderbroken.

Hoe heten de processen die met pijlen staan aangegeven?

Wat zijn de namen van deze aminozuren?

Wat is de één-letter code van de gevonden aminozuren?

UGA is een stopcodon, hoe werkt een stopcodon?

Klik nogmaals voor de antwoorden


Invloeden op niveau l.jpg
Invloeden op niveau

Vul het schema op het antwoordenblad in. Er mogen vakken leeg blijven.

Een voorbeeld voor de eerste kolom:


Invloeden op niveau7 l.jpg
Invloeden op niveau

Antwoorden van de tweede kolom:


Invloeden op niveau8 l.jpg
Invloeden op niveau

Antwoorden van de derde kolom:


Invloeden op niveau9 l.jpg
Invloeden op niveau

Antwoorden van de vierde kolom:


Wat is bioinformatica l.jpg
Wat is bioinformatica?

Schrijf termen die te maken hebben met bioinformatica op het bord.

Nu volgen twee voorbeelden van bioinformatica.

Aan het einde van de les worden de opgeschreven termen nogmaals bekeken.


Slide11 l.jpg

Voorbeeld 1:

Het vogelbekdier


Een mengelmoes l.jpg
Een mengelmoes

Zogen

Snavel

Legt eieren

Gifklieren


Ook genetische mengelmoes l.jpg
Ook genetische mengelmoes

DNA-volgorde met genen:

De genen coderen voor verschillende eigenschappen van het vogelbekdier:

ACGTGCATCGATCAACGCTACGCCCTAGCTGACTACGATTTCAGACTAGCTACGCTAGCTAGCTAGCTAGGCTTAGCTAAATCGCACATACTGCTACATATCGATACCATAGGATACAGATACAGATATAGAAATAGACACAGAGGGATAGACAGAGAGATATATAGAG

De voortplanting wordt bepaald door genen van reptielen én zoogdieren

Bestanddelen van de melk zijn hetzelfde als mensen-moedermelk

Componenten van het vogelbekdiergif komen overeen met slangengif


Evolutionair gezien l.jpg
Evolutionair gezien

Stamboom vanaf Amniotes

aangepast in 2008

Warren, W. et al. Genome analysis of the platypus reveals unique signatures of evolution Nature 453, 175-184 (2008)


Slide15 l.jpg

Symptomen:

Spierzwakte in armen en benen

Coördinatieproblemen

Beperkt gezichtsvermogen

Gehoorverlies

Onduidelijke spraak

Ongeneeslijk

Erfelijk!

Spierziekte

Mutatie in het eiwit frataxine

Voorbeeld 2:

Ataxie van Friedriech


Frataxine l.jpg
Frataxine

Frataxine is een eiwit dat betrokken is bij de verwijdering van ijzerionen (giftig!) rond de mitochondriën in het cytoplasma.

Zonder frataxine worden de zenuw- en spiercellen aangetast.

Gevolg: ruggenmerg wordt steeds dunner (degeneratie)

Gevolg: slecht evenwicht, slappe armen en benen, vaak dingen laten vallen, slechte hand-oog-coördinatie


Dna alignment l.jpg
DNA-alignment

Het gen dat codeert voor het eiwit frataxine bij Friedreich’s ataxie patiënten bevat heel veel repetities van de basen GAA:

GAA x 70 tot 1000

GAAGAAGAAGAAGAAGAAGAA

Bij het gezonde gen frataxine, wordt GAA slechts 5-30 keer herhaald.

Meer herhalingen leiden geleidelijk tot uitschakelen van het gen.

Met behulp van deze ontdekking (2006), worden specifieke medicijnen ontwikkeld! Klinische studies zijn nu gaande.


Andere toepassingen van bioinformatica l.jpg
Andere toepassingen van bioinformatica

Kennis van sterolen helpt bij het maken van cholesterolverlagende boter

Met hulp van DNAvolgordes kunnen diagnostische tests worden uitgevoerd

Bioinformatica

Enzymen die bij lage temperaturen actief zijn maken wasmiddelen beter

Selectie op genen

vergemakkelijkt

plantenveredeling


Afsluiting l.jpg
Afsluiting

Kijk nogmaals naar de termen op het bord.

Welke termen kunnen worden weggehaald?

En kunnen nieuwe termen worden toegevoed?

Tijdens het practicum kun je zelf aan de slag met bioinformatica!

Tijdens het practicum kun je zelf aan de slag met bioinformatica!


ad