1 / 41
Download Presentation

Practice Base-Paring

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Practice Base-Paring

  2. Review • Original strand: ATTCCG • Complement: • Original strand: GCTAAG • Complementary strand: • Original strand: CTACCA • Complement: • Original: • Strand A: GACCTA • Strand B: • What is the purpose of replication? • How does DNA serve as its own template?

  3. RNA Transcription & Protein Synthesis From DNA to Proteins 2 Types of nucleic acid

  4. DNA- Life’s Code DNA -> RNA -> Protein

  5. Central Dogma DNA RNA  Protein Transcription DNA  RNA Translation RNA  Protein

  6. RNA and Protein Synthesis • Why make proteins? • Skin, muscles, nails, hair, hormones, enzymes • How do we make proteins?

  7. DNA makes RNA • RNA is the 2nd type of Nucleic Acid • RNAis made of nucleotides, just like DNA • 1. Riboseis the sugar • 2. Phosphate • 3. Nitrogen Bases • Adenine (A) • Guanine (G) • Cytosine (C) • Uracil (U): NOT Thymine (T) • Single Stranded • When RNA is assembled based off of DNA’s pattern, this is called Transcription

  8. RNA and Protein Synthesis Types: • mRNA – messenger • tRNA – transfer • rRNA - ribosomal

  9. 3 Types of RNA

  10. RNA and Protein Synthesis Comparing DNA and RNA Deoxyribose Ribose A T C G A U C G Double Helix Single Stranded Nucleus. Cytoplasm, Ribosomes Nucleus

  11. DNA Transcription DNA is too large to get out of the nucleus, RNA carries DNA’s message out of the nucleus to a ribosome. Ribosome – where the protein will be made. • Occursin the nucleus • DNA is again unzipped, this timebyRNA Polymerase. • Reversibly breaks Hydrogen bonds • RNA Polymeraseadds complementary RNA nucleotides • Starting at a region called the promoter • Ending at a terminator region • This makes mRNA = messenger = carries the message • mRNAleavesthe nucleus

  12. 3 Stages of Transcription • Write on bottom of your notes… • 1. Initiation: RNA polymerase binds to the DNA at the promoterregion. • 2. Elongation: RNA polymerase moves along the coding strand of DNA, adding complementary RNA nucleotides, building the RNA transcript • 3. Termination: RNA polymerase reaches the terminator region of the DNA and is released, DNA re-coils

  13. P Deoxy-ribose Transcription Deoxy-ribose ---H--- Adenine P P P P P P P P P P P P mRNA exits nucleus Strands move apart RNA Polymerase makes mRNA RNA Polymerase breaks H-bonds DNA re-coils Ribose Ribose Deoxy-ribose Ribose Deoxy-ribose Ribose Deoxy-ribose Ribose Ribose Thymine Adenine Guanine Uracil Cytosine Guanine Guanine Adenine Adenine Uracil ---H--- P Deoxy-ribose Thymine ---H---

  14. RNA complimentary base pairingduring Transcription • DNA strand = AATTTGCGCGGCT • mRNA strand = • DNA strand = TATGCGCACTG • mRNA strand = • DNA strand = CGATCAGCCTAT • mRNA strand =

  15. Fill in the missing information

  16. Transcription

  17. Transcription: RNA Editing • Many RNA molecules require a bit of editing before they leave the nucleus. • Introns- not involved in coding for proteins • These get taken out in a process called splicing • Exons- are expressed

  18. Replication vs Transcription • Given the DNA chain below, make the complementary DNA strand and the mRNA strand that would be transcribed: • GGGCGTATTTAGCTAGACCCGAAACCC • Answer the following questions: • What is the purpose of DNA replication? Of Transcription? • What is the final product of DNA replication? Of Transcription? Be Specific. • What is the name of the enzymes(s) used in DNA replication? In transcription? • Where does DNA replication occur in the cell? Transcription?

  19. Translation • RNAtoProtein • All 3 RNA work together to create a protein molecule • Occurs at ribosomes (rRNA), tRNA act as carriers for Amino Acids • Translation: sequence of mRNA is translated into the amino acid sequence of a protein (Polypeptides) • String of amino acids held together by a peptide bond • Sequence of mRNA nucleotides is broken into a series of codons,or a sequence of three nucleotides that codes for an amino acid. • Examples: • AUG=Methionine • CUU=Leucine

  20. The Genetic Code • The genetic code translatesthe mRNA codon into an Amino Acid • AUG= Start/Methionine • UAA, UGA or UAG= Stop • Codon GCA = • Codon AAG = • Codon CGA =

  21. Translation Overview • mRNAcarriesthe DNA instructionsfor making protein • mRNA enters the cytoplasm through nuclear pores • mRNA attaches to aribosome (rRNA)to be “read” • Amino Acids are strung together (using tRNA) as ribosome “reads” mRNA to build a polypeptide chain • Ribosome reaches stop codon and detaches from mRNA • Same 3 steps as transcription • Initiation • Elongation • Termination

  22. Initiation • Ribosome binds its P site to mRNA at start codon (AUG) • Ribosome made of 3 sites: • E site: tRNA prepares to exit after dropping off Amino Acid • P site: newly arriving Amino Acid joins • A site: next in line to be added

  23. Elongation • Transfer RNA (tRNA) carrying Amino Acids enter ribosome • tRNA is complementary to mRNA • Anticodon: complementary codon on tRNA • mRNA codon: ACC • tRNA anti-codon: • mRNA codon: GUC • tRNA anticodon: • Each tRNA is specific for 1 Amino Acid

  24. Elongation • After start codon, tRNA with the anticodonmatching the next mRNA codon enters A site • Methionine and new Amino Acid form a peptide bond • tRNA carrying Met enters E site, new tRNA enters P site • Original tRNA leaves, new tRNA enters A site • This continues, adding Amino Acids to a growing polypeptide chain • Amino Acids Arrive at A site • Amino Acids bond at P site • Amino Acids Exit at E site

  25. Termination • Elongation continues until a stop codon is reached • Stop codon does not have a matching tRNA • Polypeptide chain ends, ribosome, mRNA and polypeptide chain split

  26. Translation

  27. Translation

  28. Translation Mechanism MET This process continues until a stop codon is reached, at which point the mRNA strand, tRNA units, and rRNA subunits are all released. MET ISO PRO tRNA U A C tRNA U A U tRNA U A C tRNA G GG tRNA U A U Start Codon (Methionine) Large Ribosomal Subunit (rRNA) E Site A Site P Site mRNA A A U U G G U U A A U U G G U U A G A A G G A A A A C C C C U U C C U A G U C C A A A A U U A A G G Small Ribosomal Subunit (rRNA)

  29. Translation

  30. ribosome mRNA • Process: Codon: 3 nucleotides of mRNA AntiCodon: 3 nucleotides of tRNA U G C G A U C A G A A. A. C tRNA G C A. A. U A G U A. A. C Amino Acid

  31. Process of assembling polypeptides from information encoded in mRNA; Interpreting the code! • Number the 4 anti- codons in the order they occur • TRANSLATION

  32. 1. Which two mRNA codes correspond to histidine? 2. How many different mRNA codes correspond to arginine?

  33. Protein Synthesis Summary

  34. Review • What are the three parts to the Central Dogma? • How is RNA similar to DNA? • How is RNA different from DNA? • What are the 3 types of RNA? • Recall: How do amino acids differ from each other? • What are the bonds that hold together the amino acids?

  35. Mutations • Mutations can happen in two locations: • Sex cells: affect the offspring • Body cells: affect the individualonly • Mutations can have one of three affects: • Those that cause a disease • Those that are beneficial • Silent mutations: do not cause disease – most common • Mutations can be one of two types: • Point mutations: affecting single nucleotide • Chromosomal mutations: affect section of or whole chromosome

  36. Causes of Mutations • Mistakes in base paring during DNA Replication • DNA Polymerase can usually detect such errors • When missed, may cause many genetic disorders • Chemicals: like tobacco • Can lead to cancer because it changes the genes that regulate mitosis • Radiation: includingUV (sun) andX-ray • Can lead to cancer because it changes the genes that regulate mitosis

  37. Point Mutations • 1. Substitution • One nitrogen base issubstitutedfor another • Sickle Cell Anemia: substitute A for T

  38. Point Mutations • 2. Deletions and insertions • When a nitrogen base is deletedoradded • Causes a Frame shift mutations- because it moves the codon up or down • Changes the sequence of amino acids

  39. Mutation Expression • Silent: no change in original sequence of proteins. May occur from change in base that does not change codon, or to a codon that codes for the same Amino Acid • Missense: change in one DNA base pair that results in the substitution of one amino acid for another • Nonsense: change in on DNA base pair that results in premature stop codon • Rather than coding for an Amino Acid, the stop codon ends the production of the polypeptide chain • results in a shortened protein that may function improperly or not at all. • Most ______________ outcome.

More Related