slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
A B C D E F PowerPoint Presentation
Download Presentation
A B C D E F

Loading in 2 Seconds...

play fullscreen
1 / 4

A B C D E F - PowerPoint PPT Presentation


  • 96 Views
  • Uploaded on

A B C D E F. DNA Sample Key. A: DNA from crime scene with Enzyme 1 B: DNA from crime scene with Enzyme 2 C: DNA from suspect 1 with Enzyme 1 D: DNA from suspect 1 with Enzyme 2 E:DNA from suspect 2 with Enzyme 1 F: DNA from suspect 2 with Enzyme 2. Restriction Enzymes.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'A B C D E F' - ingrid-palmer


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

A

B

C

D

E

F

dna sample key
DNA Sample Key
  • A: DNA from crime scene with Enzyme 1
  • B: DNA from crime scene with Enzyme 2
  • C: DNA from suspect 1 with Enzyme 1
  • D: DNA from suspect 1 with Enzyme 2
  • E:DNA from suspect 2 with Enzyme 1
  • F: DNA from suspect 2 with Enzyme 2
restriction enzymes
Restriction Enzymes
  • Cut DNA in at specific location based on base sequences called restriction sites

Bam HI

ATGCGTGGCCGTACTACCCATGGATCCGGGTATATAG

TACGCACCGGCATGATGGGTACCTAGGCCCATATATC

5’-GGATCC-3’

3’-CCTAGG-5’

restriction enzyme ii hae iii
Restriction Enzyme II: HaeIII

5’-GGCC-3’

3’-CCGG-5’

ATGCGTGGCCGTACTACCCATGGATCCGGGTATATAG

TACGCACCGGCATGATGGGTACCTAGGCCCATATATC