the blueprint of life from dna to protein n.
Skip this Video
Loading SlideShow in 5 Seconds..
The Blueprint of Life, From DNA to Protein PowerPoint Presentation
Download Presentation
The Blueprint of Life, From DNA to Protein

Loading in 2 Seconds...

  share
play fullscreen
1 / 67
Download Presentation

The Blueprint of Life, From DNA to Protein - PowerPoint PPT Presentation

harper-jenkins
212 Views
Download Presentation

The Blueprint of Life, From DNA to Protein

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. The Blueprint of Life,From DNA to Protein Chapter 7

  2. Preview • How does the genetic information pass on to the next generation? • How is the information stored in DNA being used to make protein? • How are the protein expression regulated?

  3. The Blueprint of Life • Characteristics of each cell dictated by information contained on DNA • DNA holds master blueprint • All cell structures and processes directed by DNA

  4. Review of DNA basics • Composed of deoxyribonucleotides • Covalently bonded in chains 5’ end (phosphate) 3’ end (hydroxyl) • Double-stranded • Strands are complementary • Base-pairing rules: • A-T • G-C • Strands are anti-parallel Two H bonds Three H bonds • Double helix • Sugar-phosphate backbone

  5. 3’ 5’ N N N N N N N N N N N N N N N N N N N N 5’ 3’ A A A A A A T T T T T T question If there are 400 cytosines in a DNA molecule that has 1000 base-pairs, how many adenines does the molecule have? C C C C G G G G

  6. Figure 7.1

  7. DNA Replication

  8. Orig. New New Orig. DNA Replication • Semi-conservative

  9. DNA Replication • Semi-conservative • Bi-directional • Second round of replication can start before first is complete • Synthesis is 5’  3’ (note: polymerase reads template 3’  5’) • DNA polymerase “reads” template, adds proper nucleotide to the 3’ end of the new chain • DNA polymerases generally corrects errors during replication (“proofreading”) • Error rate = 1/billion nucleotides • DNA polymerases require a primer (they can only add nucleotides onto an existing chain)

  10. question If a primer were available that bound to the center of the template molecule in the diagram below, which way would DNA polymerase move during DNA synthesis?

  11. 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ 3’ 5’ question 5’

  12. 3’ 5’ question 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ 5’

  13. 3’ 5’ question 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ 5’

  14. 3’ 5’ question 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ 5’

  15. 3’ 5’ question 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ 5’

  16. 3’ 5’ question 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ and so on… 5’

  17. 5’ 3’ 3’ 5’ *Depicts only a small segment of the circular chromosome DNA Replication Replication is initiated at a single distinct region (origin of replication = ori)

  18. 5’ 5’ DNA Replication Replication is initiated at a single distinct region (origin of replication = ori) 5’ 3’ 3’ 5’ A short stretch of RNA (complementary to DNA) is synthesized

  19. DNA Replication Replication is initiated at a single distinct region (origin of replication = ori) 5’ 5’ 3’ 3’ 5’ 5’

  20. DNA Replication Replication is initiated at a single distinct region (origin of replication = ori) 5’ 5’ 3’ 3’ 5’ 5’ • The replication fork (details are shown in Figure 7.6, which is optional) • Leading strand - continuous synthesis • Lagging strand - discontinuous synthesis (Okazaki fragments) • DNA ligase

  21. DNA Replication • Semi-conservative • Bi-directional • Second round of replication can start before first is complete

  22. DNA Replication

  23. Gene expression

  24. DNA to Proteins - General Principles -- .. -.-. .-. --- -... .. --- .-.. --- --. -.-- M I C R O B I O L O G Y • Morse code: Distinct series of dots and dashes encode the 26 letters of the alphabet • Letters strung together make words  sentences  stories ATGCCCGTAGATGGCCCTGAGCGACCGGACCCTGATGCC met pro val asp gly pro glu arg pro asp pro asp ala DNA: Distinct series (triplets) of the four nucleotides encode the 20 amino acids • Amino acids strung together make proteins (structural and functional) cells  organisms

  25. Transcription Translation Protein molecules RNA transcripts: Protein D D D Protein D D D D D D Protein D Protein D D D D D Protein D D D D D D D D Protein D Protein D D D D D D Protein D D D Protein D D D D D D D D D Protein D Gene Expression - Overview Coded by DNA: Protein A Protein B Protein C Protein D Protein E Protein F Protein G Protein H Protein I Gene: functional unit of DNA that contains information to produce a specific product

  26. Transcription Translation Gene Expression - Overview RNA transcripts: Protein molecules Coded by DNA: Protein A Protein B Protein C Protein D Protein E Protein F Protein G Protein H Protein I Three functional types of RNA: • Messenger (mRNA) • Ribosomal RNA (rRNA) • Transfer RNA (tRNA) rRNA tRNA

  27. OH Review of RNA basics Characteristics of RNA • Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine

  28. Characteristics of RNA Characteristics of RNA • Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine • Single-stranded • Sequence is “identical” to a stretch of one strand of DNA; complementary to the other

  29. RNA Characteristics of RNA • Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine • Single-stranded • Sequence is “identical” to a stretch of one strand of DNA; complementary to the other

  30. RNA Characteristics of RNA • Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine • Single-stranded • Sequence is “identical” to a stretch of one strand of DNA; complementary to the other Template strand Note: always read (and write) a DNA (or RNA) sequence in the 5’ to 3’ direction, or specify otherwise

  31. Bacterial Gene Expression -Transcription Transcription initiates at a promoter (sequence “theme” recognized by RNA polymerase) Transcription stops at a terminator 5’TTGACA3’ 3’AACTGT5’

  32. Bacterial Gene Expression -Transcription Initiation - RNA polymerase binds to promoter (guided by sigma factor) Elongation - RNA polymerase synthesizes RNA in 5’  3’ (no primer needed) Termination - Terms to note: Monocistronic Polycistronic (prokaryotes only) Upstream Downstream

  33. 3’T A C T A G A C T C A T A C G C G A5’ Bacterial Gene Expression -Transcription 5’ A T G A T C T G A G T A T G C G C T3’ 3’T A C T A G A C T C A T A C G C G A5’

  34. Bacterial Gene Expression -Transcription 5’ A T G A T C T G A G T A T G C G C T3’ 3’U A C U A G A C U C A U A C G C G U5’ 5’ A U G A U C U G A G U A U G C G C U3’ 3’T A C T A G A C T C A T A C G C G A5’ 5’-----------3’ 3’ACAGTT5’ 5’TTGACA3’ 3’ -----------5’

  35. Prokaryotic Gene Expression -Transcription

  36. Prokaryotic Gene Expression -Transcription

  37. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC • Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins • Message is read in triplets (codons)

  38. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC • Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins • Message is read in triplets (codons)

  39. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC • Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins • Message is read in triplets (codons) • Genetic code is degenerate But where should the ribosome start “reading”???

  40. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC • Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins • Message is read in triplets (codons) • Genetic code is degenerate • But where should the ribosome start “reading”??? • Eukaryotes (moncistronic messages only)- translation begins at first AUG • Prokaryotes (monocistronic and polycistronic messages) - translation begins at first AUG after a ribosome-binding site

  41. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC Proper reading frame is critical AUG

  42. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC Proper reading frame is critical

  43. Bacterial Gene Expression - Translation tRNAs are the “keys” that decipher the code • Each tRNA carries a specific amino acid • Each tRNA has a specific anticodon, complementary to a codon, that binds mRNA

  44. Bacterial Gene Expression - Translation E P A Initiation 5’ Elongation translocation elongation factors

  45. Bacterial Gene Expression - Translation Termination

  46. Bacterial Gene Expression - Translation

  47. Eukaryotic Gene Expression

  48. Prokaryotic Gene Expression

  49. Eukaryotic Gene Expression