250 likes | 445 Views
From DNA to Protein. True Purpose of Genetic Material – Central Dogma. A. Overview. DNA, as genetic blueprint of life, dictates how to make every living thing Every cell’s job is to produce protein Why protein? Animals : enzymes, membranes, organelles, muscle, skin, hair = protein
E N D
From DNA to Protein True Purpose of Genetic Material – Central Dogma
A. Overview • DNA, as genetic blueprint of life, dictates how to make every living thing • Every cell’s job is to produce protein • Why protein? • Animals: enzymes, membranes, organelles, muscle, skin, hair = protein • Plants: enzymes, membranes, organelles = protein • Life = protein!
Making protein is cell’s doctrine or dogma • Central dogma: steps necessary to produce protein • Step 1: DNA transcribed to RNA • Step 2: RNA translated to protein
B. Transcription (txn) • Double-stranded (ds) DNA found in nucleus of eukaryotes (cytoplasm of prokaryotes) • Code of bases (A-C-G-T) on DNA determines what type of protein synthesized in cytoplasm • Problem: DNA trapped in nucleus, can’t leave • Solution: use different nucleic acid that’s able to leave nucleus = single-stranded (ss) RNA (ribose nucleic acid or ribonucleic acid)!
Steps of Txn (nucleus) • Step 1: RNA polymerase binds to DNA • Step 2: RNA polymerase unwinds & unzips DNA • Step 3: RNA polymerase adds complementary RNA bases to DNA • All bases are same as DNA except RNA uses uracil instead of thymine DNA: A T C C A G G T C A T G C A A G C RNA: RNA: U A G G U C C A G U A C G U U C G
Txn can occur at different DNA forks (just like replication) • Different segments of DNA called “genes” that code for different proteins/items T A C G A T T A C A G C A Gene 1
C. RNA • Three types of RNA made depending on work needed • Messenger RNA (mRNA) • brings information from DNA in nucleus to outside cytoplasm • Ribosomal RNA (rRNA) • Contains ribosome that clamps onto mRNA to put amino acids in right order • Transfer RNA (tRNA) • carries amino acids to rRNA for assembly
Nucleic acid double-strand Single-strand PO4 Deoxy-ribose adenine RNA DNA ribose cytosine thymine uracil guanine
D. Translation (trl) • Act of making protein from mRNA • Recall: amino acids are building blocks of proteins • mRNA sequence is “read” • Nucleotide sequence codes for 20 different types of amino acids • Group of 3 nucleotides (triplet or codon) codes for 1 amino acid • Ex: UUU codes for phenylalanine UAC codes for tyrosine
= asparagine Ex: AAC mRNA Codes
Let’s practice: • Step 1: put blocks around every 3 bases (1 codon) • Step 2: look up letters in mRNA code • Step 3: write down amino acid sequence - leucine lysine - proline - lysine - alanine - asparagine AAACCUAAGGCCAACCUAAGGACC - arginine - threonine
Trl has repetition to compensate for possible mistakes & codes to start & stop • Repetition: proline is coded for by CCU, CCC, and CCA • Start: codon AUG is where tln starts (methionine) • Stop: codons UGA, UAA, UAG where trl stops • Try it again! • Do NOT start boxing codons until see START codon “AUG” • Stop translating when see STOP codon (UGA, UAA, or UAG) AACCAUGAAGGCCAACCUAUAGGACCG Protein = methionine–lysine-alanine-asparagine-leucine
Steps of Translation • 1. DNA undergoes transcription in nucleus to make mRNA • 2. mRNA leaves nucleus, enters cytoplasm & travels to ribosome (solo or on roughER) • 3. free-floating tRNA binds to free-floating amino acids in cytoplasm based on anticodon & transports them to rRNA/ribosome complex • 4. ribosome bonds codon in mRNA to anticodons in tRNA, binding amino acids in right order until reaches STOP codon
Step 1: Txn in Nucleus ribosome tRNA amino acid dsDNA mRNA
Step 2: mRNA ribsome mRNA dsDNA mRNA
Step 3a: tRNAbinds aa mRNA dsDNA
Step 3b: tRNA/aato ribosome try Amino acid tRNA mRNA dsDNA mRNA A C C anticodon
his Step 4a: tRNA/aato mRNA try met tRNA tRNA tRNA Ribosome G U A A C C U A C C A U U G G U A A G A U G mRNA
try met his Step 4b: aa join as protein tRNA tRNA tRNA Ribosome (rRNA) A C C U A C G U A C A U U G G U A A G A U G mRNA
QUIZ – Thursday 12/6/12 • 20 multiple choice questions (20 points) • 2 short answer (10 points)