1 / 33

Veterinary drugs Specificity:

Veterinary drugs Specificity:. Legal substances Large usage Need Treatment and prevention Usage in different species. Efficacy. Target: parasites. Veterinary drugs : endectocides. Meat Fat Milk. Food security. Environment. 80% of parental compound is excreted in feces.

doyle
Download Presentation

Veterinary drugs Specificity:

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Veterinary drugs Specificity: • Legal substances • Large usage • Need • Treatment and prevention • Usage in different species

  2. Efficacy Target: parasites Veterinary drugs: endectocides Meat Fat Milk Food security Environment 80% of parental compound is excreted in feces

  3. Pharmacology Drug • Absorption • Distribution • Metabolisme • Elimination • Toxicity • Efficacy Pharmacokinetic Pharmacodynamy

  4. Pharmacokinetics Fate of drugs in the host organism • Many complex mecanisms • 3 main famillies of actors act in synergy

  5. Cytochromes Metabolisation Transferases Transfer of gluthation Glucuronide, sulfone MRP Transporters Efflux Phase II Phase III Phase I MRP Pgp X-OH X-Glu X X X-Glu Fate of drugs in the host organism Exemple of a hepatic cell Xenobiotic X

  6. 3 main actors • Cytochromes Phase I • Transférase Phase II • Efflux ABC transporters Phase III

  7. 2- Mechanisms of transmembrane transport of drugs – Examples • Paracellular diffusion • ions, mannitol, polymers • Passive diffusion across lipid bilayer • fluoroquinolones, tetracycline (hydrophobic) • Diffusion through OM channels and porins • b-lactams, tetracyclins (hydrophilic, charged) • Facilitated diffusion • imipenem, catechols, albomycin, albicin • Active Transport • aminoglycosides, cycloserine, phosphomycin, alaphosphin • Vesicle Trafficking Mediated Transport • polymers, peptide hormones, targeted delivery

  8. Active transporters • Multiplicity • Rates > passive • Non-symmetrical (kin kout at [Si] = [So]) • Saturable transport -Michaelis-Menten • Inhibitable- competitive, non-competitive • Regulated-inducibility & repression • Tissue specific-differential expression Energy dependent-active transport • primary pumps - respiration, photosyn, ATPase • secondary transporters (coupled to H+, Na+ etc.)

  9. Active efflux ABC-transporters ATP-Binding Cassette transporters : ATP dependant transport Active efflux of a large amount of substrates: ions, steroïdes, phospholipids, conjugated molecules, peptides…..drugs… Trans-membranedomaines Nucleotide-binding-domains: ATPase activity

  10. Human ATP-Binding Cassette Transporters ABC MDR : multidrug resistant

  11. Multidrog resistance transporters P-gp, MRPs, BCRP • ATP-Binding cassette familly: ABC transporters • Mediate the active efflux of xenobiotics Large specificity of substrates • Involved in multidrug resistance • Ubiquitus localisation Gène Protéine Structuresecondaire Localisation cellulaire ABCB1 Apical P-glycoprotéine P-gp Multidrug rresistant protein MRP1,2,3 2 Apical 1, 3 Basolatéral ABCC1,2, 3 MRP 4, 5 ABCC4, 5 4 Apical 5 Basolatéral Breast cancer resistant protein BCRP ou MXR ABCG2 Apical

  12. Doxorubicine Anthracyclines Daunorubicine Aldosterone Epirubicine Stéroides Dexamethasone Progesterone Alcaloïdes de la vinca Vincristine Corticosterone Vinblastine Gramicidine D Epipodophyllotoxines Etoposide Valinomycine Teniposide N-Acetyl-leucyl-leucyl-norleucine NAc-Leu-Leu-norLeu-al Taxanes Paclitaxel Peptides cyclique et linéaire NAc-Leu-Leu-Met-al Docetaxel Leupeptin Pepstatine A Colchicine Facteur A Actinomycine D Cyclosporine A Agents cytotoxiques Emétine Valspodar (PSC 833) Topotecan Mithramycine Verapamil Mitomycine Bloqueur des canaux calciques Nifedipine Azidopine Ritonavir Dexniguldipine Inhibiteurs des protéases Indinavir Saquinavir Quinidine Bépridil Rhodamine 123 Réserpine Hoechst 33342 Autres Morphine Colorants Fura-2 AM Bromocriptine Acridine Forskoline 99mTc-SESTAMIBI Ivermectine Calcéine-AM Substrates of P-glycoproteine

  13. Substrates of MRPs ou cMOAT (canalicular multispecific organic anion transporter) • glutathione disulfide • leukotrienes (C4, D4, E4, N-acetyl-E4) • glutathione conjugates (e.g., DNP, bromosulfophthalein, metals Sb, As, Bi, Cd, Cu, Ag, Zn) • glucuronide conjugates (bilirubin, T3, p-nitrophenol, grepafloxacin) • bile acid conjugates (glucuronides and sulfates) • organic anions (folates, methotrexate, ampicillin, ceftiaxone, cefadozime, grepafloxacin, prevastatin, temocaprilate)

  14. P-glycoprotein and “multidrug resistance” (MDR) • Gene of Pgp: MDR1 in humans and mdr1a/1b in rodents • Phenotype of multidrug resistance (MDR) in tumor cells

  15. Localisation on main epithelial barriers Brain liver Intestine Testis Kidney Placenta ……. Protection against xenobiotics Overexpression in cancer cells

  16. Cellular localisation Distribution between apical and basolateral pole

  17. Summary: role of P-gp • At cellular level • Lower intracellularbioavailability of xenobiotic (drugs) • Lowertoxicity • Lower drug efficacy • In the whole animal • Physiologicalcompounds: • excretion of metabolites or toxins • Xenobiotics: • Lower intestinal absorption • Increase intestinal and biliaryelimination • Reduces disposable fraction of the drugs • Protects the central nervous system

  18. ATP ADP 1 12 NH2 ATP ATP COOH Out Protein expression Substrate ATPase In Inhibitor Tools to study MDR transporters • Models • Cells, vesicles • Whole animal • Parasites Methodology

  19. Drug Interactions & Drug TransportCinical assays in humans • Digoxin - non-metabolized substrate for PgP • Verapamil, amiodarone, and quinidine increase plasma levels, reduce renal and non-renal clearance, increase blood/brain barrier transport. Dose adjustment may be needed in 50% of cases. • St. John's wort (Hypericum perforatum) decreased digoxin AUC by 25% after 10 days treatment through induction of PgP. • HIV Protease Inhibitors • Amprenavir clearance reduced by nelfinavir (-41%) and by indinavir (-54%), but not saquinavir. • FDA warning against Hypericum supplements

  20. Drug Resistance & Reversal • MDR1 (P-glycoprotein) – drug efflux pump • Multiple trials of multiple agents – recent efforts at inhibiting transcription • Steady state digoxin therapy was established in normal healthy volunteers (1 mg then 0.125 mg/day). Initiation of valspodar (400 mg followed by 200 mg twice per day) caused immediate and progressive increases in digoxin AUC (+211%) and decreases in total body, renal, and non-renal clearance (-67%, -73%, -58%) after 5 days. • BCRP(breast cancer resistance protein or ABCG2) • Inhibited by fungal toxin fumitremorgin C, but neurotoxic side effects • Kol143 and other derived analogs developed inhibit BCRP, but not PgP or MRP • Non-toxic in mice, increased oral availability of topotecan in mice • RFC (reduced folate carrier) - antifolate drugs (methotrexate) • Resistant leukemia cell lines were selected by stepwise doses • Cross resistance (>2000x) to five novel hydrophilic antifolates shown • Intracellular folate levels reduced, increased requirement 42x • Hypersensitive to hydrophobic antifolates • Mutations clustered in exons 2 and 3, TMD1

  21. Exemple of veterinary drugs Macrocyclic lactones: potent parasiticides

  22. Lactones macrocycliques: • 1/3 of veterinary drugs are parasiticides anti-parasitaires • (among them 60% are macrocyclic lactones) • High efficacy with large spectrum: endectoparasiticide • Massive utilisation versus optimized utilisation

  23. Prevention and therapy = Necessity Emergence of resistant parasites Endectocidal Macrocyclic Lactones Large use of MLs We must give existing active compounds the best chance to work

  24. Ivermectin X = - CH2- -CH - R = CH(CH )CH CH 2 2 1 3 2 3 Abamectin B X = -CH=CH- R = CH(CH )CH CH 1a 1 3 2 3 Doramectin X = -CH=CH- R = Cyclohexyl 1 Eprinomectin B X = -CH=CH- R = CH(CH )CH CH R = NHCOCH 1 a 1 3 2 3 2 3 H O O H N O O O O H O H O H I. Macrocyclic lactones (MLs) a. Généralités et Structure 4 23 AVERMECTIN 13 22 25 13 MILBEMYCIN Moxidectin

  25. Route administration Molecule Species Pathophysiology O M e H O O M e M e O O O O M e O O O O Efficacy O O O H O O H Pharmacokinetics of MLs Toxicity Adipose tissue Storage Brain Plasma Liver Biotransformation Entero-hepatic cycle Biliairy elimination Intestinal secretion Intestine Milk Feces • Low liver biotransformation • High P-glycoprotein interaction

  26. P-gp and Ivermectin O M e H O O M e M e O O O O M e O O O O O O O H O O H Ivermectin Out 1 12 In NH2 ATP ATP COOH Ivermectin • Brain • Intestine • Overall bioavailability • Parasite

  27. Neurotoxicity Ivermectin 0.2 mg/kg SYMPTOMS: • • Ataxia • • Tremors • • Mydriasis • • Coma Alteration of Pgp function Pgp and ivermectin neurotoxicity Brain Murray -Grey ? Natural model Colley CF-1 Mdr1ab -/- Artificial model Ivm sensitivity of colley dogs

  28. tgctggtttttggaaacatgacag - - - - ctttgcaaatgcaggaatttcaagaaacaaaacttttccagttataattaatgaa Ivm Sensitive male tgctggtttttggaaacatgacag - - - -ctttgcaaatgcaggaatttcaagaaacaaaacttttccagttataattaatgaa Ivm sensitive female Beagleof reference tgctggtttttggaaacatgacagatagctttgcaaatgcaggaatttcaagaaacaaaacttttccagttataattaatgaa …… - - - - - - - - - N M T D S F A N A G I S R N K T F P V I I N E Sensitive Colley - - - - - - - - - N M T A L Q M Q E F Q E T K L F Q L Stop Colley sensitive Beagle Synthesis of a truncated protein of78 aa Lack of protein in tissues Deletion of 4 base pairs on P-gp gene (exon 2) Genetic disorder in Ivm sensitive Colley Deletion Colley Premature Stop Codon Beagleof reference Western Blot Intestine P-gp (Roulet et al 2003)

  29. Intestinal excretion of ivermectin 5 4 Control 3 50 Verapamil 40 30 2 Ivermectin (ng / cm / kg) ** 20 10 1 0 ileum jejunum duodenum 0 100 200 400 In situ model Intestinal closed loop Small Intestine Bile Ivermectin (µg/kg BW) Dose (µg/kg) Involvement of ABC transporters Ratiointestine / bile= 5 Laffont et al. 2002 29

  30. Pharmacokinetics of ivermectin P-gp deficient mice mdr1ab-/- Ivermectin concentration in plasma (ng/ml)

  31. In vivo P-gpreversing agents • Verapamil in rat (Alvinerie et al, 1999) • Quercetin in sheep (Dupuy et al. 2003) • Loperamide in sheep (Lifschitz et al. 2004) • Verapamil in sheep (Molento et al, 2004) • Itraconazole and valspodar in rat (Ballent et al, 2006) • Ketoconazole in dog (Alvinerie, unpublished data) Impact on bioavailability of MLs

  32. Ketoconazole and ivermectin Ivermectin concentration in dog plasma Ivermectin concentration (ng/g)

  33. O R2 O O O X H H O O O H R1 O O O H O H O H O H La P-gp module l’exposition et Efficacité thérapeutique des LMs Médicament HôteParasite Transporteurs ABC SNC toxicité BHM Tissu adipeux Absorption Dose administrée Distribution Efficacité Transport lipoprotéines Parasite Parasite Eimination Résistance Transporteurs ABC Transporteurs ABC

More Related