100 likes | 525 Views
Human Identity Testing. Purpose: Match a person to a DNA sample. Examples:. Paternity Test Genetic History Historical (Thomas Jefferson, Sally Hemings) Genealogical Forensic Missing Persons Identifying body parts. Forensic DNA. Source: Any biological material containing cells.
E N D
Human Identity Testing Purpose: Match a person to a DNA sample. Examples: • Paternity Test • Genetic History • Historical (Thomas Jefferson, Sally Hemings) • Genealogical • Forensic • Missing Persons • Identifying body parts
Forensic DNA Source: Any biological material containing cells Examples: • Blood • Hair (must have root) • Bone / teeth • Saliva • Urine • Semen • Vaginal secretions • Futuristic: discarded epidermal cells
CODIS(Combined DNA Index System) Purpose: Allow participating laboratories to exchangeand compare profiles at a national level in electronic form. Factoids: • 1990: pilot launched by FBI • 1994: DNA Identification Act passed (authorized FBI to implement a national forensic data base) • 1998: became operational • 2000: added missing persons
TPOX D3S1358 TH01 D8S1179 D5S818 VWA FGA D7S820 CSF1PO AMEL D13S317 AMEL D16S539 D18S51 D21S11 CODIS: 13 STR Loci and AMEL
TCATTCATTCATTCATTCATTCAT TCATTCATTCATTCATTCATTCATTCATTCAT 7 6 1 2 3 4 5 6 1 2 3 8 5 6 7 1 2 3 4 5 4 TCATTCATTCATTCATTCATTCATTCAT STR(Short Tandem Repeat) TH01: TCAT repeat in the first intron of the tyrosine hydroxylase gene
Frequency Number of repeats STR Allele Frequencies 45 40 TH01 Marker 35 30 Caucasians (N=427) 25 Blacks (N=414) 20 Hispanics (N=414) 15 10 *Proc. Int. Sym. Hum. ID (Promega) 1997, p. 34 5 0 6 7 8 9 9.3 10
Genotyping at the TH01 Locus: Moe: 7/9 Larry: 9.3/9.3 Curly: 6/9 Reference 10 6 7 8 9 9.3
Moe: 7/9 Larry: 9.3/9.3 Curly: 6/9 CrimeScene DNA
AMEL(amelogenin locus) • quick, inexpensive sex determination • AMEL gene on X chromosome has 6 fewer base pairs than the gene on the Y chromosome • XX give one “short” peak • XY give two peaks, one “short” and one “long”
Human Identity Testing with Multiplex STRs AmpFlSTR® SGM Plus™ kit D3 TH01 amelogenin D8 VWA D16 D19 D21 D18 D2 FGA D3 amelogenin D19 D8 D16 VWA D21 D18 D2 FGA TH01 Simultaneous Analysis of 10 STRs and Gender ID firstperson secondperson