claude
Uploaded by
1 SLIDES
92 VIEWS
10LIKES

Genetic Structure of Common Loons in Northeast North America

DESCRIPTION

This study investigates the genetic makeup of breeding populations of Common Loons to link wintering birds with their specific breeding regions. Using microsatellite loci, the research uncovers distinctions in the genetic structure of loons across North America, shedding light on the impacts of various threats. Samples were collected from distinct regions, and PCR techniques were applied to analyze the allele distribution. The results show genetic differentiation between eastern and western populations, offering crucial insights into the year-round impacts on these birds.

1 / 1

Download Presentation

Genetic Structure of Common Loons in Northeast North America

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Locus Primer sequence (5’ to 3’) Upper: Forward, Lower: Reverse Repeat sequence No. alleles Allele size (range) GimA12EPA HEX-TTCATTGAGTGTAATAATGGCGA TTGGAGGGATGGATGGACGG (CCAT)8 7 138 (129-153) GimC5EPA FAM-AGTGATGCAGAAGAGGGTGG GGTTTGGGTCACAGCTGAAT (GT)4GG (GT)7 4 108 (102-112) GimE11EPA TET-GGGAGTATTAACAGCCAGCC CCCCATCTCCTGTTTTCTCA (GA)8(TA)3 (CA)7 2 146 (146-148) GimD9EPA FAM-TTAGGTGGAACAGCTCTGGG CTTCTTGCCCTGATCTCCAG (GT)9 4 169 (173-181) GimA9EPA TET-CACAGCACAAGAACAAGCGT TTATGGGGCTTTTGTATGGC (GT)7 3 147 (143-147) Table 1. Characteristics of five polymorphic microsatellite loci in Gavia immer. Primer sequences are listed with the fluorescent dye label indicated. Allele size is the predicted size (bp) of the cloned allele with the observed allelic size distribution for each locus in parentheses. Table 2. Sample size (n) and allele frequencies for each locus by region. Eastern region numbers correspond to Figure 2 where 1=New York, 2=Massachusetts-southern New Hampshire (NH), 3=Vermont and northwestern NH, 4=northeastern NH and northern Maine (ME), 5=southeastern ME, Nova Scotia, and New Brunswick. Preliminary Analysis of Common Loon (Gavia immer) Genetic Structure in Northeast North America Based on Five Microsatellite Loci Amy M. McMillan, State University of New York College at Buffalo; Mark J. Bagley, United States Environmental Protection Agency, Cincinnati, Ohio; and David C. Evers, BioDiversity Research Institute, Gorham, Maine Courtesy of BioDiversity Research Institute Abstract This study seeks to determine fine-scale genetic structure of Common Loon breeding populations in order to link wintering birds with their breeding regions. Common Loons are large piscivorous birds that breed in lakes of northern North America and Iceland. Loons are highly philopatric and territorial in breeding areas and are susceptible to mercury poisoning, lake acidification and other threats across much of this region. Wintering loon populations originate from a mix of breeding regions. In North America, wintering populations are found primarily in nearshore coastal environments and these birds are susceptible to oil spills. Loons also are threatened by the current botulism poisoning outbreak, which has killed thousands of loons in the Great Lakes. Despite significant demographic data, little is known about the population genetic structure of Common Loons. Preliminary analysis using five polymorphic microsatellite loci demonstrated strong differentiation between loons in eastern and western North America (R X C exact test X2 = 48.14, df = 10, P = 0.000). Differentiation among five putative eastern loon breeding populations was also identified. Differences were found in four of ten pairwise comparisons. The information developed on loon population structure will be crucial for understanding year-round impacts on these birds. • Materials and Methods • Common Loon samples collected from western (California, Nevada, Washington States; n=70) and Eastern (Maine, Massachusetts, New Hampshire, New York, Vermont, Virginia States; New Brunswick, Nova Scotia, Quebec Provinces; n=323) North America between 1997-2001 • DNA extracted from blood samples using Qiagen DNeasy tissue kit • Five polymorphic microsatellite loci (Table 1) used to determine population structure (McMillan et al. 2004) • 15 µl PCR reactions: 3 pmol each labeled forward and unlabeled reverse primer, 250 μM each dNTP, 1.5 mM MgCl2, 0.6 U Taq DNA polymerase, and 15 ng template DNA in buffer containing 20 mM Tris-HCl and 50 mM KCl (pH 8.0) • Touch-down thermal regime: 1 min at 95○C; 12 cycles of 30 sec at 95○C, 30 sec at 64○C, dropping 0.8○C for each subsequent cycle, 45 sec at 72○C; 23 cycles of 30 sec at 95○C, 30 sec at 54○C, 45 sec at 72○C; 5 min at 72○C; 10○C hold • Alleles visualized with MJ Research Basestation and sized with Cartographer software • Data analysis with TFPGA (Miller 1997) and POPGENE (Yeh et al. 1997) • Results • Two to seven alleles were present at each locus. Allele frequencies for each locus varied from nearly monomorphic (GimE11EPA) to highly polymorphic (Table 2). • All populations were in Hardy-Weinberg equilibrium at all loci except for locus GimE11EPA (POPGENE, Chi-square test). Fewer birds with allele 2 were seen than expected in the East coast birds and in the Vermont/Northern New Hampshire population. • Breeding populations from the eastern and western portions of North America were genetically distinct (TFPGA, R X C exact test X2 = 48.14, df = 10, P = 0.000; Raymond and Rousset 1995). • Eastern birds showed a complicated pattern of relationships (Table 3). For this preliminary study, we anticipated potential breeding populations based on geographic features that did not support breeding loons (i.e., mountain ranges, extensive areas without breeding-quality lakes, etc.). Population differentiation was tested based on these putative populations (Figure 2). Four out of 10 pairwise exact tests for population differentiation were found statistically different (Table 2) although these differences did not follow any obvious spatial pattern. BioDiversity Research Institute (www.briloon.org) 4 3 5 1 2 Table 3. Matrix of combined probabilities for each pairwise comparison between areas in the eastern region (exact test for population differentiation, Raymond and Rousset 1995). Heading numbers correspond to Figure 2 where 1=New York, 2=Massachusetts-southern New Hampshire (NH), 3=Vermont and northwestern NH, 4=northeastern NH and northern Maine (ME), 5=southeastern ME, Nova Scotia, and New Brunswick. Figure 2. Putative metapopulation of Common Loons in northeastern North America. Figure 1. Range and migratory routes of the Common Loon in North America. Discussion These are preliminary findings in a long-term study of Common Loon genetic structure. This study will help to determine the spatial scale in which to model loon environmental impacts, particularly MeHg. Our results suggest a relatively long-term split between the eastern and western geographic regions of North America and show that the Pacific and Atlantic migratory routes represent genetically distinct populations (Figure 1). Within the eastern portion of North America it appears there are genetic difference among regions but that that these relationships need further exploration. For this preliminary study we assumed populations based on geographic structures or areas that would seem to prevent dispersal between breeding areas. Further investigations will consider other possible population boundaries and a mixed stock analysis (e.g., Pritchard et al. 2000), which will help determine the number of populations represented in this region. This study suggests that locus GimE11EPA may not be useful in distinguishing populations since it is relatively monomorphic and does not meet Hardy-Weinberg expectations in some cases. Overall variability in this study is not very high. Further development of microsatellite markers or additional, more variable markers (i.e., AFLP) may be used to help define the Common Loon metapopulation structure. Introduction Common Loons have been studied as a primary indicator of the impacts of methyl mercury (MeHg) and other stressors on ecological health for over a decade (Burgess et al. 1998, Evers et al. 1998, Meyer et al. 1998) with sampling primarily concentrated in northeastern North America. This has resulted in a voluminous database on loon density and distribution, behavior and natural history (based primarily on marked loons), and characterization of the exposure and hazards of mercury and other environmental stressors. Because loons are a high trophic predator and environmental risks are well-documented, the U.S. Environmental Protection Agency (USEPA) is using them to model wildlife risk. In order to place the environmental risk assessment of loons into a spatial framework, the genetic structure of Common Loons in their breeding territories must be understood. The summer breeding range of the Common Loon encompasses northern North America and wintering areas include coastal waters (Figure 1). Adult loons return to the same breeding area and usually the same lake (mean dispersal distance = 2km); juveniles disperse only slightly further (mean = 13km; Evers 2000). This suggests a metapopulation structure where breeding loons are divided into relatively discrete habitat “areas” separated by large areas of unsuitable habitat (Figure 2). Previous work with RAPD markers suggests that loons from the midwest and northeast are genetically distinct (Dhar et al. 1997) but no other studies have been published using molecular methods to define loon populations. The primary objective of this study is to define breeding populations of Common Loons using microsatellite markers. Genetic subdivision between loons from different breeding areas may manifest into differences in stressor-response profiles for these birds. Geographic information on reproductive success, fitness measurements (e.g., feather weight asymmetry), demographic processes, toxicological exposure, and non-chemical stressors will be placed in a spatially-explicit framework for stressor-response models if loon subpopulations can be defined. Loon populations can be artificially defined by lake regions, topological features such as mountain ranges, or by convenient distances. However, whether birds within our defined areas interact, more specifically, interbreed or exchange genes, is of utmost importance to understand stressor effects. Courtesy of BioDiversity Research Institute Literature Cited Burgess, N, D Evers, J Kaplan, J Kerekes, and M Duggan. 1998. Mercury and reproductive success of common loons breeding in the maritimes. Mercury in Atlantic Canada: A progress report. Environment Canada Atlantic Region, Sackville, NB. Dhar, AK, MA Pokras, DK Garcia, DC Evers, ZJ Gordon, and A Alcivar-Warren. 1997. Analysis of genetic diversity in common loon Gavia immer using RAPD and mitochondrial RFLP techniques. Molecular Ecology 6: 581-586. Evers, DC, JD Kaplan, MW Meyer, PS Reaman, A Major, N Burgess, and WE Braselton. 1998. Geographic trend in mercury measured in Common Loon feathers and blood. Environ. Tox. Chem. 17(2): 173-183. Evers, DC. 2000. Approaches and application in the capture and color-marking of the Common Loon (Gaviaimmer). Ph.D. Dissertation, St. Paul, Minnesota. McMillan, AM, MJ Bagley, and DC Evers. 2004. Characterization of seven polymorphic microsatellite loci in the Common Loon (Gavia immer). Molecular Ecology Notes 4: 297-299. (reprints available) Meyer, MW, DC Evers, JJ Hartigan, and PS Rasmussen. 1998. Patterns of common loon (Gavia immer) mercury exposure, reproduction, and survival in Wisconsin, USA. Environ. Tox. Chem. 17(2):184-190. Miller, MP. 1997. Tools for population genetic analysis (TFPGA) 1.3: A Windows program for the analysis of allozyme and molecular population genetic data. Computer software distributed by author. Pritchard, JK, M Stephens, and P Donnelly. 2000. Inference of population structure using multilocus genotype data. Genetics 155: 945-959. Raymond, ML and F.Rousset. 1995. An exact test for population differentiation. Evolution 49: 1280-1283. Yeh, FC, R-C Yang, TBJ Boyle, Z-H Ye, and JX Mao. 1997. POPGENE, the user-friendly shareware for population genetic analysis. Molecular Biology and Biotechnology Centre, University of Alberta, Canada. http://www.ualberta.ca/~fyeh/

More Related