fig 20 11 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Fig. 20-11 PowerPoint Presentation
Download Presentation
Fig. 20-11

Loading in 2 Seconds...

play fullscreen
1 / 23

Fig. 20-11 - PowerPoint PPT Presentation


  • 106 Views
  • Uploaded on

Northern Blot (to detect CD4 mRNA). TECHNIQUE. Heavy weight. I II III. RNA. Nitrocellulose membrane (blot). Gel. Sponge. T cells. B cells. macrophage. Paper towels. Fig. 20-11. Alkaline solution. 2. 1. 3. Preparation of restriction fragments. DNA transfer (blotting).

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Fig. 20-11' - basil


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
fig 20 11

Northern Blot (to detect CD4 mRNA)

TECHNIQUE

Heavyweight

I II III

RNA

Nitrocellulosemembrane (blot)

Gel

Sponge

T cells

B cells

macrophage

Papertowels

Fig. 20-11

Alkalinesolution

2

1

3

Preparation of restriction fragments

DNA transfer (blotting)

Gel electrophoresis

Radioactively labeledprobe forCD4 gene

Probe base-pairswithmRNA

I II III

I II III

Film overblot

Nitrocellulose blot

4

5

Probe detection

Hybridization with radioactive probe

fig 20 13

Reverse Transcriptase PCR (RT-PCR) to detect CD4 mRNA

TECHNIQUE

1

cDNA synthesis

mRNAs

cDNAs

Fig. 20-13

Primers

2

PCR amplification

CD4 mRNA

3

Gel electrophoresis

Different cell types

RESULTS

1 2 3 4 5 6

fig 20 15

Microarrays to detect many (or all) mRNAs at once

TECHNIQUE

Tissue sample

1

Isolate mRNA.

Fig. 20-15

2

Make cDNA by reversetranscription, usingfluorescently labelednucleotides.

mRNA molecules

Labeled cDNA molecules(single strands)

DNA fragmentsrepresentingspecific genes

3

Apply the cDNA mixture to amicroarray, a different gene ineach spot. The cDNA hybridizeswith any complementary DNA onthe microarray.

DNA microarray

DNA microarraywith 2,400human genes

4

Rinse off excess cDNA; scanmicroarray for fluorescence.Each fluorescent spot represents agene expressed in the tissue sample.

slide4

Example of array data

genes

WT

dif1

∆ dif1

myb98

∆ myb98

slide6

Human Genome Project (Multinational Consortium)

1990-2003

“Divide and conquer” approach

Entire 3 x 10^9 nucleotide sequence of a composite haploid human genome

~$500 million - $1 billion

Celera Genomics (Private Company)

1998-2003

Shotgun sequencing approach

~ $300 million

slide9

Fig. 20-12a

How can we sequence DNA? (Sanger dideoxy method)

TECHNIQUE

DNA(template strand)

Primer

Deoxyribonucleotides

Dideoxyribonucleotides(fluorescently tagged)

dATP

ddATP

dCTP

ddCTP

dTTP

ddTTP

DNA polymerase

dGTP

ddGTP

slide10

Fig. 20-12b

TECHNIQUE

DNA (template strand)

Labeled strands

Shortest

Longest

Directionof movementof strands

Longest labeled strand

Detector

Laser

Shortest labeled strand

RESULTS

Last baseof longestlabeledstrand

Last baseof shortestlabeledstrand

slide11

How can we sequence an entire genome?

Linkage mapping

1

Genetic

markers

Physical mapping

2

Overlapping

fragments

DNA sequencing

3

slide12

How can we sequence an entire genome?

  • Genome sequencing:
  • Divide and conquer approach
  • Ordered, large fragments of chromosomes are cloned

Linkage mapping

1

Genetic

markers

Physical mapping

2

Overlapping

fragments

DNA sequencing

3

fig 20 4 4

Hummingbird cell

TECHNIQUE

Bacterial cell

lacZ gene

Restrictionsite

Stickyends

Gene of interest

Bacterial plasmid

ampR gene

Hummingbird DNA fragments

Fig. 20-4-4

Nonrecombinant plasmid

Recombinant plasmids

Bacteria carryingplasmids

RESULTS

Colony carrying recombinant plasmid with disrupted lacZ gene

Colony carrying non-recombinant plasmidwith intact lacZ gene

One of manybacterial

clones

slide14

How can we sequence an entire genome?

Genome sequencing:

Divide and conquer approach

- Ordered, large fragments of chromosomes are cloned

-Each fragment is sequenced

Linkage mapping

1

Genetic

markers

Physical mapping

2

Overlapping

fragments

DNA sequencing

3

slide15

1

Cut the DNA

into overlapping

fragments short enough

for sequencing

“Shotgun” sequencing approach

2

Clone the fragments

in plasmid or phage

vectors.

3

Sequence each

fragment.

4

Order the

sequences into

one overall

sequence

with computer

software.

slide16

The Human Genome (partial sequence….)

TTATTTCCCATTTTTCTTAAAAAGGAAGAACAAACTGTGCCCTAGGGTTTACTGTGTCAGAACAGAGTGTGCCGATTGTGGTCAGGACTCCATAGCATTTCACCATTGAGTTATTTCCGCCCCCTTACGTGTCTCTCTTCAGCGGTCTATTATCTCCAAGAGGGCATAAAACACTGAGTAAACAGCTCTTTTATATGTGTTTCCTGGATGAGCCTTCTTTTAATTAATTTTGTTAAGGGATTTCCTCTAGGGCCACTGCACGTCATGGGGAGTCACCCCCAGACACTCCCAATTGGCCCCTTGTCACCCAGGGGCACATTTCAGCTATTTGTAAAACCTGAAATCACTAGAAAGGAATGTCTAGTGACTTGTGGGGGCCAAGGCCCTTGTTATGGGGATGAAGGCTCTTAGGTGGTAGCCCTCCAAGAGAATAGATGGTGAATGTCTCTTTTCAGACATTAAAGGTGTCAGACTCTCAGTTAATCTCTCCTAGATCCAGGAAAGGCCTAGAAAAGGAAGGCCTGACTGCATTAATGGAGATTCTCTCCATGTGCAAAATTTCCTCCACAAAAGAAATCCTTGCAGGGCCATTTTAATGTGTTGGCCCTGTGACAGCCATTTCAAAATATGTCAAAAAATATATTTTGGAGTAAAATACTTTCATTTTCCTTCAGAGTCTGCTGTCGTATGATGCCATACCAGAGTCAGGTTGGAAAGTAAGCCACATTATACAGCGTTAACCTAAAAAAACAAAAAACTGTCTAACAAGATTTTATGGTTTATAGAGCATGATTCCCCGGACACATTAGATAGAAATCTGGGCAAGAGAAGAAAAAAAGGTCAGAGTTTAATCCTCATTCCTAAGTTATGTAAACCAAAAATAAAATTCTGAAGATGTCCTGATCATCTGAATGGACCCTTCCTCTGGACCAGGGCATTCCAAAGTTAACCTGAAAATTGGTTTGGGCCATGATGGGAAGGGAGGTTTGGATATGCCTCATTATGCCCTCTTCCCTTTCAGAATTCAGGAAAAGCCAACCAGCATTAACATCAACACAGATTTTCAGATCTTAGGTTTCTTTCCGATCTATTCTCTCTGAACCCTGCTACCTGGAGGCTTCATCTGCATAATAAAACTTTAGTCTCCACAACCCCTTATCTTACCCCAGACATTCCTTTCTATTGATAATAACTCTTTCAACCAATTGCCAATCAGGGTATGTTTAAATCTACCTATGACCTGGAAGCCCCCACTTTGCACCCTGAGATCAAACCAGTGCAAATCTTATATGTATTGATTTGTCAATGAAAACAGTCAAAGCCAGTCAGGCACAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGTAGATCACCTGAGGTCAGGAGTTCGACACCAGCCTGGCCAACATGGTGAAACCCCGTCCCTACTAAAATACAAAAATTAGCCCAGCTTGGTGGTGGGCACCTGTAATCTTAGCTACTGCAGAGACTGAGGCAGGAGAATCGCTTGAACCCAGGAGGTGGAGGTTGCAGTGACCTGAGATTTTGCCATTGCACTCCAGCCTGGGCAACAGAGCAAGACTCTATCTCAAAAAACAAACAAACAAACAAACAAACAAACAAACTGTCAAAATCTGTACAGTATGTGAAGAGATTTGTTCTGAACCAAATATGAATGACCATGGTCCATGACACAGCCCTCAGAAGACCCTGAGAACATGTGCCCAAGGTGGTCACAGTGCATCTTAGTTTTGTACATTTTAGGGAGATATGAGACTTCAGTCAAATACATTTTTAAAAAATACATTGGTTTTGTCCAGAAAGCCAGAACCACTCAAAGCAGGGGTTTCCAGGTTATAAGTAGATTTAAAATTTTTCTGATTGACAATTGGTTGAAAGAGTTGTCAATAGAAAGGAATGTCTGCATTGTGACAAGAGGTTGTGGAGACCAAGTTTCTGTCATGCAGATGAAGCCTTCAGGTAGCAGGCTTCCAAGATAACAGGTTGTAAATAGTTCTTATCAGACTTAAGTTCTGTGGAGACGTAAAATGAGGCATATCTGACCTCCACTTCCAAAAACATCTGAGACAGGTCTCAGTTAATTAAGAAAGTTTGTTCTGCCTAGTTTAAGGACATGCCCATGACACTGCCTCAGGAGGTCCTGACAGCATGTGCCCAAGGTGGTCAGGATACAGCTTGCTTCTATATATTTTAGGGAGAAAATACATCAGCCTGTAAACAAAAAATTAAATTCTAAGGTCCCTGAACCATCTGAATGGGCTTTCTTCTAGGCCAGGGCACTCTAAAATTGAAGAACCTGAACATTCCTTTCTATTGATAATACTTTCAGCCAGTTGAGCCCATTCAGACCACAGCAAGGTGCCAGGCCAGGCAAGGGCTGACTTGAGATACCTGCCAGATGAGTCACTGGCAAAAGGTGCTGCTCCCTGGTGAGGGAGAAACACCAGGGGCTGGGAGAGGCCCAGAAGGCTCTGAAGGAGTTTTGGTTTGGCTGGCCATGTGTGCAATTAGCGTGATGAGCTCTGACATGGCCTTGCATGGACGGATTGGGCAGGACACCCCAGCTGAGGAGGATGGCAGGAGTGATGGCACAGGGGAAAGGGTGGCATACCCAGGTGACAGCTCCCCACTACCTCCACTCTGTGCTGCAGCTCAGGGGCTGGGTCTTCTGCTGCAACTCAGCCCCTCTGTACCAGCCCTGGCCTCATTCCCTTGGTTCCAGGACACCCAGCTGACAAAAGGGACTTGCCTGTACCCCTGCACCTGGTCCTACACCTGGCTCCTGGGTTGTCAGCAGGTGTTTGTTGGGCCAACGAGTGCATGGATGGAAACACAGACAGAAGGACAGATGGAGAGATGGTGGGTGGCCAGACAAAGGAGTAACTTGGTGAGGAATGTGCATTAGGAAATCACAGAAGAGCAGAAACTGTTTGAAAATTCCAAGTGGGGAAAGTGAGGAGGTGAAGCAGGGCTGAAGGGCCTCCCTCAGAGCCTTCTCCCACTCTGTGGTGTCCACATCCCCTTGGTCGTCCTTGTGGGAGGCACTCACCTTTTGCTCAGCCTATTGTGGCTACAGCCCAGCAGGTCCCAGGTGGCACCAGCCAAGATGAAGGTGGCATTGAGGGCTGAAGTCTCCCTCACCATGAAGGGATGATGTATAGTGGGTGGGGCCTCAGGAGGAAGAG

GGCCACCAACCCTACCTGGCCCCTAACCTGCTGCCTGGAGTAGGCAGGTACCAGAGGCATGGGGTGAGGCATGTTGCAGGTCGAGGACCAGGGCCATCTCACTGCCTGAGCCCATGGACTGGCTCAGGGGTCTGTCAGATGATTCTAGAGCTGAGTTGGAGGTAAGGGCAGGGGGTTTGTTCCTGGGTTCAAGACCATGGAAGGAAGGGGTAGAGAAGGAGGCCAACAAGTGAGGAGGCAAATTACAGTGGCTGGCAGAAGGAGAGAGAAGCCAGGACAGGTGGCTGTGGCCCTGTCCCTGCAGGCAGACCCAGGAAGGAGCTCAGAGACAGGATTCATGCCAAGCCTGCCTACCCAGCACATCTCTCCTCATGGACATGAGAGAAAACCCTCCAGCTTGGCCCTCACATCTGTGAAACCCACAGTAATGGGGCTGACATCCTCTGCCCTATGCAAGAGAGGTTTCCCAAGCACTTGCAGCAAGTGAGACTGCACAGGATGGCGAATCCACAAAGAACACGTTGTTCTCATGCTCTTTGGAAGCACCAATTTACATTCTG

fig 21 7

Exons (regions of genes coding for protein

or giving rise to rRNA or tRNA) (1.5%)

Repetitive

DNA that

includes

transposable

elements

and related

sequences

(44%)

Introns and

regulatory

sequences

(24%)

Fig. 21-7

Unique

noncoding

DNA (15%)

L1

sequences

(17%)

Repetitive

DNA

unrelated to

transposable

elements

(15%)

Alu elements

(10%)

Simple sequence

DNA (3%)

Large-segment

duplications (5–6%)

slide19

Comparison of gene organization in different species (centered on region containing RNA polymerase gene)

fig 21 9a

New copy of

transposon

Transposon

Fig. 21-9a

DNA of

genome

Transposon

is copied

Insertion

Mobile transposon

(a) Transposon movement (“copy-and-paste” mechanism)

fig 21 9b

New copy of

retrotransposon

Retrotransposon

Fig. 21-9b

RNA

Insertion

Reverse

transcriptase

(b) Retrotransposon movement

slide22

Large scale sequencing of cDNA fragments

Reverse Transcriptase PCR (RT-PCR)

TECHNIQUE

1

cDNA synthesis

mRNAs

cDNAs

Primers

2

PCR amplification

Sequence large numbers (millions) of cDNA fragments

3

Gel electrophoresis

slide23

Large scale sequencing of cDNA fragments

No UV

(3 samples)

UV

(3 samples)

Fragments matching rad51