slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Molecular Characterization of Invasive Group A Streptococci in Alaska 2000 - 2008 PowerPoint Presentation
Download Presentation
Molecular Characterization of Invasive Group A Streptococci in Alaska 2000 - 2008

Loading in 2 Seconds...

play fullscreen
1 / 26

Molecular Characterization of Invasive Group A Streptococci in Alaska 2000 - 2008 - PowerPoint PPT Presentation


  • 122 Views
  • Uploaded on

Molecular Characterization of Invasive Group A Streptococci in Alaska 2000 - 2008. Karen Rudolph, Ph.D. Arctic Investigations Program DEISS, NCPDCID, CCID, CDC. Objectives. List two questions molecular strain typing can address. Describe the two common molecular strain typing techniques.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Molecular Characterization of Invasive Group A Streptococci in Alaska 2000 - 2008' - amaya-goodwin


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Molecular Characterization of Invasive Group A Streptococci in Alaska

2000 - 2008

Karen Rudolph, Ph.D.

Arctic Investigations Program

DEISS, NCPDCID, CCID, CDC

objectives
Objectives

List two questions molecular strain typing can

address.

Describe the two common molecular strain typing

techniques.

List three reasons why molecular strain typing

of group A streptococci is important.

slide3

Molecular Strain Typing

  • Used to address two questions:

 Are isolates recovered from a localized

outbreak of disease the same or different

strains?

 How are strains causing disease in one

geographic area related to those isolated

world wide?

  • Method should be highly discriminatory which

refers to the ability to differentiate among unrelated

strains.

slide4

Molecular Strain Typing

Pulsed-field Gel Electrophoresis (PFGE)

slide5

Molecular Strain Typing

Pulsed-field Gel Electrophoresis (PFGE)

  • DNA is forced to change

direction

Large fragments take longer to

realign in each field – move

a shorter distance

 Shorter fragments realign faster and

travel farther

  • Run time of 20 hrs
slide6

Molecular Strain Typing

Pulsed-field Gel Electrophoresis (PFGE)

  • 291 kb
  • 194
  • 145.5
  • 97
  • 48.5
slide7

Pulsed-field Gel Electrophoresis (PFGE)

Dendogram

Coefficient of similarity

slide8

Molecular Strain Typing

Multilocus Sequence Typing (MLST)

slide9

Molecular Strain Typing

Multilocus Sequence Typing (MLST)

1.

>aroe

GAAGCGAGTGACTTGGCAGAAACAGTGGCCAATATTCGTCGCTACCAGATGTTTGGCA

TCAATCTGTCCATGCCCTATAAGGAGCAGGTGATTCCTTATTTGGATGAGCTGAGCGAT

GAAGCGCGCTTGATTGGTGCGGTTAATACGGTTGTCAATGAGAATGGCAATTTAATTG

GATATAATACAGATGGCAAGGGATTTTTTAAGTGCTTGCCTTCTTTTACAATTTCAGGT

AAAAAGATGACCCTGCTGGGTGCAGGTGGTGCGGCTAAATCAATCTTGGCACAGGCTA

TTTTGGATGGCGTCAGTCAGATTTCGGTCTTTGTTCGTTCCGTTTCTATGGAAAAAACAA

GACCTTACCTAGACAAGTTACAGGAGCAGACAGGCTTTAAAGTGGATTTGTGT

>gdh

AGAACACTTTATCCGTGGACAATACCGCTCTGGTAAGATTGATGGCATGAAATACATCT

CTTATCGTAGCGAACCAAATGTGAATCCAGAATCAACAACTGAAACCTTTACATCTGGTG

CCTTCTTTGTAGACAGCGATCGATTCCGTGGTGTTCCTTTCTTTTTCCGTACAGGTAAAC

GACTGACTGAAAAAGGAACTCATGTCAACATCGTCTTTAAACAAATGGATTCTATCTTTG

GAGAACCACTTGCTCCAAATATTTTGACCATCTATATTCAACCAACAGAAGGCTTCTCT

CTTAGCCTAAATGGGAAGCAAGTAGGAGAAGAATTTAACTTGGCTCCTAACTCACTTGA

TTATCGTACAGACGCGACTGCAACTGGTGCTTCTCCAGAACCATACGAGAAATTGATTT

ATGATGTCCTAAATAACAACTCAACTAACTTTAGCCACTGGGAT

2.

http://www.mlst.net/databases

3.

Allelic profile:

aroe_8 gdh_13 gki_13 recP_4 spi_17 xpt_4 ddl_14

4.

Streptococcus pneumoniae - Allelic Profiles query results

Your sequence type is 199

slide10

Molecular Strain Typing

Multilocus Sequence Typing (MLST)

eBURST Analysis:

S. pneumoniae with a central founder

ST199 and 12 linked SLVs;

two of the SLVs have diversified

to produce DLVs. eBURST, unlike cluster

diagrams, trees, or dendograms, uses a simple model

of bacterial evolution in which an ancestral (or founding)

genotype increases in frequency in the population and

while doing so begins to diversify to produce a cluster

of closely related genotypes that are all descended from

the founding genotype.

slide11

Multilocus Sequence Typing

Advantages

  • Sequencing uncovers all variations at a gene locus.
  • Identity of alleles is unambiguous using sequencing

data.

  • Electronic portability of DNA sequences - allows

labs to characterize bacterial isolates by submitting

sequence data via the internet to a central MLST

database.

slide13

Streptococcus pyogenes

  • group A streptococci (GAS), Gram-positive, spherical

or ovoid cells in chains, -hemolytic on blood agar

  • Exclusively human pathogen;

transmitted by respiratory droplet or

contact with infected wounds

  • Colonize the throat or skin
  • Infections range from mild to severe:

- pharyngitis, impetigo, scarlet

fever

- bacteremia, pneumonia, meningitis,

necrotizing fasciitis (NF), streptococcal toxic shock

syndrome (STSS)

slide14

Streptococcus pyogenes

Burden of Illness

  • Worldwide, GAS is important cause of morbidity and
  • mortality with an estimated 517,000 deaths each year.
  • In the U.S. (2000 – 05), the average annual incidence

rate of invasive GAS disease was 3.5 cases per

100,000 persons with 735 deaths (case fatality rate of 13.7%).

  • Highest incidence among persons ≥65 years of age
  • (9.4 cases per 100,000 persons), and children <1 year
  • of age (5.3 cases per 100,000 persons).
  • Case fatality rate (22.8%) highest among the elderly.
slide15

Rates of Invasive GAS Disease in

Alaska, 2000 - 06

Overall annual incidence rate – 4.7 cases/100,000persons

slide16

Streptococcus pyogenes

Control Strategies

  • Identification and prevention of risk factors

- young age (<2), elderly (≥65)

  • Vaccination

- 26-valent vaccine; in phase 2 clinical trials

  • Treatment

- -lactams have been the treatment of

choice

slide17

Streptococcus pyogenes

Serotyping

  • 1928 – Rebecca Lancefield established method

based on antigenic variation of the M protein

  • Considered the gold standard
  • >90 M serotypes described
  • Problems associated with M serotyping:

- limited availability of M typing antisera

- newly encountered M types (high nontypeability rate)

- difficulty in interpretation

slide18

Streptococcus pyogenes

emm sequence typing

  • N-terminal hypervariable region of M protein gene.
  • Concurs with M serotyping for most serotypes 1:1.
  • Validated in the mid-1990s.
  • 225 distinct emm types encompassing 450 subtypes.
  • Problems associated with M serotyping are avoided.
slide19

emm type Distribution of Invasive GAS

Isolates in Alaska, 2000 - 08

- Top ten emm types account for 66% of isolates.

- Vaccine emm types account for 61% of isolates.

slide20

emm type Distribution of Invasive GAS

Isolates by Time Period

  • 2000 – 04, N = 99; 2005 – 08, N = 113
  • Increase in emm73, emm82, emm108
  • Decrease in emm41, emm76, emm83, emm114
  • p <0.0001
slide24

Antimicrobial Susceptibilities

aSusceptibility testing for GAS isolates began in 2004.

slide25

Conclusions

  • GAS is an important cause of invasive bacterial

disease particularly among the AK Native population.

  • emm types seen in Alaska similar to rest of U.S.

with exception of emm41, emm92, and emm1

  • 26-valent GAS vaccine would prevent ~61% of cases
  • Continued surveillance is warranted

- to improve understanding of epidemiology

- for notification of possible outbreaks

- to monitor changes in emm types for vaccine development

slide26

Acknowledgements

23 Labs participating in the statewide surveillance program

AIP Microbiology Lab AIP Nursing staff

- Alisa Reasonover - Debby Hurlburt

- Marcella Harker-Jones - Kim Boyd-Hummel

- Julie Morris

Tammy Zulz – AIP Surveillance Coordinator

Dana Bruden – Statistician

Debbie Parks – Database Manager

Dr. Mike Bruce – Medical Epidemiologist

The findings and conclusions in this presentation have not been formally disseminated by the Centers for Disease Control and Prevention (CDC) and should not be construed to represent any CDC determination or policy