proteasas de fasciola hepatica n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Proteasas de Fasciola hepatica PowerPoint Presentation
Download Presentation
Proteasas de Fasciola hepatica

Loading in 2 Seconds...

play fullscreen
1 / 49

Proteasas de Fasciola hepatica - PowerPoint PPT Presentation


  • 208 Views
  • Uploaded on

Proteasas de Fasciola hepatica. PROTEASAS DE Fasciola hepatica. Fasciola hepatica. Causa la Fasciolosis Afecta rumiantes Zoonosis emergente, varios millones infectados en Bolivia y Perú Produce pérdidas multimillonarias a nivel global. Ciclo biológico de Fasciola hepatica.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Proteasas de Fasciola hepatica' - alice


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
proteasas de fasciola hepatica

Proteasas de Fasciola hepatica

PROTEASAS DE

Fasciola hepatica

fasciola hepatica
Fasciola hepatica
  • Causa la Fasciolosis
  • Afecta rumiantes
  • Zoonosis emergente, varios millones infectados en Bolivia y Perú
  • Produce pérdidas multimillonarias a nivel global
problemas en el control de la fasciolosis
Problemas en el control de la Fasciolosis
  • Drogas efectivas pero costosas
  • Animales se reinfectan con facilidad
  • Tratamiento no evita el daño hepático
  • Focos de resistencia en Europa
selecci n de los productos de excreci n secreci n e s como objeto de estudio
Selección de los productos de excreción/ secreción (E/S) como objeto de estudio
  • Se pueden obtener en forma relativamente sencilla en cantidades aceptables a partir de gusanos adultos
  • La fasciola tiene intestino ciego por tanto regurgita el contenido.
  • Sus componentes entran en contacto con el medio interno del huésped.
  • Tienen composición menos compleja que el homogeneizado somático
actividad gelatinolitica de los productos de e s de fasciola hepatica
ACTIVIDAD GELATINOLITICA DE LOS PRODUCTOS DE E/S DE FASCIOLA HEPATICA

CL1 gelatinolytic activity

CL2

29 kDa

CL1

27,5 kDa

CL2 gelatinolytic activity

catepsinas l de fasciola
Catepsinas L de Fasciola
  • Son el 80% de los productos de E/S
  • Producidas y secretadas por células del tubo digestivo
  • CL1 de 27,5 kDa es mayoritaria
  • CL2 de 29 kDa
  • Se diferencian por actividad sobre péptidos fluorogenicos sintéticos
slide9
Actividades de CL1 y CL2 de Fasciola hepatica sobre peptidos fluorogénicos acoplados a AMCKcat/KmM-1.s-1
actividades in vitro de los pes de fasciola hepatica sobre igg1 humana
Actividades in vitro de los PES de Fasciola hepatica sobre IgG1 humana

Digestion of IgG1 by Fasciola hepatica E/S products and immunological characterization of the main released products. IgG1l (100 mg) was incubated for 22 h with F. hepatica E/S products(10 mg) at pH 7.3 and 37 C. Proteins were run on 12.5% SDS–PAGEunder nonreducing (left) and reducing conditions (right) and stained with CBB R-250 (lanes 1 through 4) or electrotransferred to nitrocelluelectrotransferred to identify the main digestion products by Western blotting using specific antisera (lanes a through h): Lanes 1 and 4, IgG1l undigested control; lanes 2 and 3, IgG1l 1 E/S products; lanes a and e, anti-L chain; lanes b and f, anti-Fd; lanes c and g, anti-Fcg, lanes d and h, anti-g1 H chain.

actividades in vitro de las catepsinas l de fasciola hepatica sobre iggs humanas sitios de corte
Actividades in vitro de las Catepsinas L de Fasciola hepatica sobre IgGs humanasSitios de corte
slide13
Actividades de PES y Catepsinas L de Fasciola hepatica sobre inmunoglobulinas humanas de clase IgGConclusiones
  • CL1 y CL2 son las principales responsables de la degradación de las subclases de IgG con PES a pH 7.2 a manera de la papaína produciendo los fragmentos Fab y Fc
  • A pH 5.5 los PES producen la degradación adicional a fragmentos pequeños derivados de la porción Fc
  • Sólo IgG3 es clivada en ausencia de DTT
  • Los sitios de corte determinados para CL1 y CL2 no se corresponden con los aa P1 y P2 de los sustratos sintéticos utilizados para determinar la actividad catepsina L (Phe-Arg )
slide18
Catepsinas L de Fasciola: Actividad proteolitica sobre componentes de la matriz extraceular y las membranas basalesConclusiones
  • Colágeno I: es degradado por los PES y en menor medida por CL1 y CL2 en presencia de Cys.
  • Colageno III: es clivado tanto por PES como por las CLs.
  • Colágeno IV: degradado completamente por los PES sin Cys, y por CL1 y CL2 en presencia de Cys.
  • Elastina: No se observa actividad proteolitica.
  • Laminina: Es cortada por PES, CL1 y CL2.
  • Fibronectina: Es atacada por PES, CL1 y CL2 produciendo patrones de corte diferentes.
inhibici n de las catepsinas l de fasciola hepatica por anticuerpos de conejos infectados
Inhibición de las Catepsinas L de Fasciola hepatica por anticuerpos de conejos infectados
  • Conejos infectados con 30MT c/u y sangrados hasta s20
  • IgGs purificadas por afinidad
  • Incubación IgGs con CLs, 20min, relación 10:1
slide21
Inhibición de las Catepsinas L de Fasciola hepatica por anticuerpos de conejos infectados y tratados
  • La actividad gelatinolítica de ambas catepsinas desaparece a las 4-5 semanas postinfección y reaparece 2-4 semanas después del tratamiento con triclabendazol
slide22

ENSAYO DE VACUNACION

Groups: CL1

CL2 Control

Wk0 4 6 20

Inmumization Booster Challenge Necropsy

(100 ug antígen in CFA) (100 ug antígeno in IFA) (300 metacercariae)

slide23

ELISA ANALYSIS OF IgG RESPONSES AGAINST CL1 AND CL2 IN SHEEP FROM TRIAL 1

CL2 CL1

A.U.

A.U

300

600

500

250

400

200

300

150

200

100

100

50

0

0

0

2

4

6

8

10

12

14

16

18

20

22

0

2

4

6

8

10

12

14

16

18

20

22

Semanas

Semanas

CONTROL

CL1

CL2

slide24

Worm burdens and FEC in sheep vaccinated against F. hepatica with CL1 and CL2 in Trial 1

Group Eggs/g Egg output reducción Flukes % worm

Feces (%) recovered reduction

CL1 41,8+/-41,2 71 109,1+/-24,6 34

CL2 28,0+/-38 81 107+/-40,1 33

Control 141,8+/-75,6 100 161,4+/-21,4 100

otras proteasas de fasciola hepatica
OTRAS PROTEASAS DE FASCIOLA HEPATICA
  • DIPEPTIDIL PEPTIDASA (DPP)
  • LEUCIN AMINOPEPTIDASA (LAP)
  • CATEPSINA B
  • LEGUMAINA
dipeptidil peptidasa dpp
DIPEPTIDIL PEPTIDASA (DPP)
  • Actividad presente en PES de adultos
  • Clivaje preferncial de Gly-Pro y Lys-Ala
  • Novel con relación a las DPPs de mamíferos
  • Aún sin caracterización molecular
lap de fasciola hepatica
LAP de Fasciola hepatica
  • Metaloproteasa Zn++ dependiente purificada de extracto soluble en deoxicolato
  • Holoenzima hexamérica formada por subunidades de 67 kDa
  • Asociada a tubo digestivo
  • Purificada por columna de afinidad con su inhibidor Bestatina
  • Trazas en los PES
slide28

TRIAL DESIGN

Groups: CL1+CL2

LAP

CL1+CL2+LAP Control

Wk0 4 6 20

Inmumization Booster Challenge Necropsy

(100 ug antígen in CFA) (100 ug antígeno in IFA) (300 metacercariae)

slide29

WESTERN BLOT ANALYSIS OF IgG RESPONSE AGAINST F. HEPATICA PROTEINASES IN SHEEP DURING THE COURSE OF VACCINATION TRIAL

Groups:

Weeks:

Control CL1+CL2 LAP CL1+CL2+LAP

LAP

CL2

CL1

P L P L P L P L P L P L P L P L P L P L P L

0 12 0 6 12 0 6 12 0 6 12

P =E/S products

L =Leucine aminopeptidase

slide30

IgG ANTI-LAP RESPONSE IN GROUPS OF SHEEP VACCINATED AGAINST FASCIOLOSIS IN TRIAL 2

7000

A.U.

6000

5000

CONTROL

4000

LAP

CL1-CL2

3000

CL1-CL2-LAP

2000

1000

0

0

2

4

6

8

10

12

14

16

18

20

22

Weeks

slide31

450

400

CONTROL

350

LAP

CL1-CL2

300

CL1-CL2-LAP

250

200

150

100

50

0

0

2

4

6

8

10

12

14

16

18

20

22

Weeks

IgG ANTI-CL2 RESPONSE IN GROUPS OF SHEEP VACCINATED AGAINST FASCIOLOSIS IN TRIAL 2

A.U.

slide32

800

700

600

500

400

300

200

100

0

0

2

4

6

8

10

12

14

16

18

20

22

Weeks

IgG ANTI-CL2 RESPONSE IN GROUPS OF SHEEP VACCINATED AGAINST FASCIOLOSIS IN TRIAL 2

A.U.

CONTROL

LAP

CL1-CL2

CL1-CL2-LAP

slide33

Worm burdens recovered in sheep vaccinated against F. hepatica with CL1, CL2 and LAP in Trial 2

GROUP: CL1-CL2 GROUP: CONTROL

Animal No. Flukes recovered Animal No. Flukes recovered

104 56 101 126

110 89 119 59

114 0 122 54

121 0 134 56

125 5 139 65

128 1 Mean 72

135 0

136 0

137 57

Mean 23,1

slide34

Worm burdens recovered in sheep vaccinated against F. hepatica with CL1, CL2 and LAP in Trial 2

GROUP: LAP GROUP: CL1-CL2-LAP

Animal No Flukes recovered Animal No Flukes recovered

106 0 102 43

107 1 116 0

113 38 120 0

123 0 124 0

130 0 127 30

132 0 138 0

Mean 6,5Mean12,1

slide35

Reduction in F. hepatica worm burdens obtained

in Trial 2 with CL1, CL2 and LAP

Group Reduction (%)

LAP 89,6

CL1-CL2 60,1

CL1-CL2-LAP 79,3

slide37

Ensayos in vitro muestran una correlación positiva entre la capacidad de inhibición de la actividad enzimática por parte de los anticuerpos LAP específicos y los niveles de protección alcanzados

construcci n del producto lap completo

5´RACE

3´RACE

Construcción del producto LAP completo

M 3´ 5´

5 Ciclos

Generación de FL

2Kb

1,3 kb

PCR 20 Ciclos

Amplificación de FL

slide39

10 20 30 40 50 60 70 80 90 100 110 120 130 140 150

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

GGGGGGGAATTGGCAATGGCGGCGTTGGCTGTGGGCGTGTCTGATCTGTCGGATAAGCGGTTCGACGTTGTTATATTCATCAACGATGATGCCGACGAGGGATGCGCGAAGGATGCGGCCGTGTATGAAGCCTTGAAATCATTCTCCAAA

M A A L A V G V S D L S D K R F D V V I F I N D D A D E G C A K D A A V Y E A L K S F S K

160 170 180 190 200 210 220 230 240 250 260 270 280 290 300

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

ATCAATCCTAATTTAGGTAGTGAACTGTCAATTGTTCCGTTTCCTGCCCATCCATCTGGACGACTGATCTACAGTCCAACAGGAGCATTGAACACGGACACGGCGGATATACGCAACGTGTATGATGCTGCTTGCGCTGGAGTCAAACGT

I N P N L G S E L S I V P F P A H P S G R L I Y S P T G A L N T D T A D I R N V Y D A A C A G V K R

310 320 330 340 350 360 370 380 390 400 410 420 430 440 450

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

GCCCTGTCAATGGGGTGTCATGCTCCTCTGCTCTATCTGGGCTCACTTCGTTCCGCCTCTTTTGGATTTGAGTGGATGCAACGCAAACATCTGCTACTCAATGCTCTGCTTGGCGCGTACCATGCACTCTATCTGCCACTGGAAGTACGT

A L S M G C H A P L L Y L G S L R S A S F G F E W M Q R K H L L L N A L L G A Y H A L Y L P L E V R

460 470 480 490 500 510 520 530 540 550 560 570 580 590 600

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

GAGATGAGACCCACAACAGGACTAAAAGCCCAACATTTGGGTGTGAAAGAGGACACAAAAGGGTCGGACGAGTTGGTTCTACGCTTGGCTATGGCTCTTGAGGAAGGTCGCTGGCTTGCACGAGATATCGGTGGTTCCGATCCGGAACGA

E M R P T T G L K A Q H L G V K E D T K G S D E L V L R L A M A L E E G R W L A R D I G G S D P E R

610 620 630 640 650 660 670 680 690 700 710 720 730 740 750

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

ATGGCTGCACCCAGAATTGTGGACTATCTGAAAACTTCACTCGGTGGTATGAAGGGAATTACCATGAGTGTGGAAAAGGTGGACATTCAGAAATACCCTCTGATGGCTGCGGTGAATCGTGCGGCATCCGTTGTCGCACGCCATGACGGA

M A A P R I V D Y L K T S L G G M K G I T M S V E K V D I Q K Y P L M A A V N R A A S V V A R H D G

760 770 780 790 800 810 820 830 840 850 860 870 880 890 900

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

CGCGTGGTTCATCTCAAGTACGAGCCGCCCAATCCAACCGAGGTGGATACGACTCTTTACTTGATTGGAAAAGGTATCACTTATGACACCGGTGGAGCAGACATCAAGGCGAACGGAGTGATGGCTGGAATGCATCGGGACAAGTGTGGT

R V V H L K Y E P P N P T E V D T T L Y L I G K G I T Y D T G G A D I K A N G V M A G M H R D K C G

910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

GCGGCTGCGATTGCTGGTTTGTTCAAAACTCTGGGTGAACTTCAACCTCCGGGACTGTCAGTGTCCGCCGCGCTGGCTTTCGTGCGCAACAGTGTTGGTGCAGATTCGTATGTGGCCGATGAGATTCTGGTAGCTCGTTCCGGCCAACGT

A A A I A G L F K T L G E L Q P P G L S V S A A L A F V R N S V G A D S Y V A D E I L V A R S G Q R

1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

ATTCGCGTAGGAAACACGGATGCCGAGGGTCGCATGGTGATGACTGATCTGTTGTGCGAAGCAAAAGAGAAGGCAATCAATGCAACAAATCCGTTCCTCTTCACAATTGCTACTCTTACCGGCCATGTGGTACGGGCGTATAAACACTAT

I R V G N T D A E G R M V M T D L L C E A K E K A I N A T N P F L F T I A T L T G H V V R A Y K H Y

1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

ACGGCGGTCATGGACAATGGACCACCGCGTATACACCGTGTGTCTCAAAGTCTGCAAGAAGCTGGCGATCGTATTTCGGATATGGCTGAAATTTCAACTGTGCGTAAAGAAGACTACGAATTCAACCGAGGTAAAACGGAGTACGAGGAT

T A V M D N G P P R I H R V S Q S L Q E A G D R I S D M A E I S T V R K E D Y E F N R G K T E Y E D

1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

ACTCTTCAGTGCAACAATCTTCCCAGCAGTGCCACTCCTCGGGGTCATCAAATTCCGGCGGCATTCATGGCATTGGCTAGTGGATTGGACAAGCACGGATTGGGCTCTGCCAAACCAATTCCATACACGCATGTGGATGTGGCTGGCAGT

T L Q C N N L P S S A T P R G H Q I P A A F M A L A S G L D K H G L G S A K P I P Y T H V D V A G S

1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

GCAACAGAAATTCACGTGTTGCCCACTGCCGCCCCTCTGTTGATGTTCGCCAGCCGTTACGTACTACCACGACTGGGATTCAAATAGGGCACCCGACACGTGTCACGTGCAGTCGATTCGTGGATATTTCCAACATTTCATTTGGATACG

A T E I H V L P T A A P L L M F A S R Y V L P R L G F K *

1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

AATTTGTTTTGTCAATATTCGGTGGGATCAAACCATTGCGGATACTTTTTTTTACAATGTCTTCCATACCGGTTTGATTAATGGGACCCTTTCCCACCAAAACCCCCCAAAAAAAACTCTGTCATGCCGTTACGTAGCGTATCGTTGACA

...

GCA

fhlapr expresi n en e coli pthiohis c
FhLAPr Expresión en E.coli pThioHis C

M SI I

Inducción IPTG 1mM

2hs 37°C

Lisados celulares totales

purificaci n

M 1 2 3 4 5 6 7 8

Purificación

500 ml de cultivo

Columna quelante Hi Trap (Ni)

Binding: 50 mM Tris

01 M NaCl

pH 8.3

Elución: 50 mM Imidazol

1 Muestra 2 No retenido 3 Control

4, 5, 6 Eluidos 7 s/ inducir 8 inducido

catabolismo de la hemoglobina
Catabolismo de la hemoglobina

GLOBULOS ROJOS

HEMOLISIS

saposina

Hb esófago

ENDOPEPTIDASAS

ej: catepsina L1

catepsina B

catepsina D

POLIPEPTIDOS gastrodermis

lúmen del ciego

LEGUMAINA

EXOPROTEASAS

ej: catepsina C,

dipeptidilpeptidasa

Aminopeptidasa?

DIPÉPTIDOS gastrodermis

lúmen del ciego

slide44

Reactividad cruzada entre FhLAPn y FhLAPr

Inmunoblot

Suero de oveja inmunizada con FhLAPn

Suero de conejo inmunizado con FhLAPr

SDS PAGE 12,5% condiciones reducidas

slide45

Maldi-Tof de FhLAPn

14 péptidos

192 residuos reconocidos en 523

36,7% de cobertura

>FheLAPr

MAALAVGVSDLSDKRFDVVIFINDDADEGCAKDAAVYEALKSFSKINPNLGSELSIVPFPAHPSGRLIYSPTGALNTDTADIRNVYDAACAGVKRALSMGCHAPLLYLGSLRSASFGFEWMQRKHLLLNALLGAYHALYLPLEVREMRPTTGLKAQHLGVKEDTKGSDELVLRLAMALEEGRWLARDIGGSDPERMAAPRIVDYLKTSLGGMKGITMSVEKVDIQKYPLMAAVNRAASVVARHDGRVVHLKYEPPNPTEVDTTLYLIGKGITYDTGGADIKANGVMAGMHRDKCGAAAIAGLFKTLGELQPPGLSVSAALAFVRNSVGADSYVADEILVARSGQRIRVGNTDAEGRMVMTDLLCEAKEKAINATNPFLFTIATLTGHVVRAYKHYTAVMDNGPPRIHRVSQSLQEAGDRISDMAEISTVRKEDYEFNRGKTEYEDTLQCNNLPSSATPRGHQIPAAFMALASGLDKHGLGSAKPIPYTHVDVAGSATEIHVLPTAAPLLMFASRYVLPRLGFK

slide47

Leu-AMC

Phe-AMC

Determinación de parámetros cinéticos

slide48

Respuesta humoral de ovinos (ELISA)

0 4 6 10 15 20 25

4

Priming

Recuerdo

Desafio

slide49

Recuperación de parásitos en ensayo de inmunización en conejos

Porcentaje de Protección

(Control – Inmunizado) x 100 Control

78%

Recuperación

Grupo Control = 18%

Grupo Inmunizado = 4%