450 likes | 627 Views
The Pledge, The Peacock, & You. Tim Dallas, Ph.D. Assistant Professor of Electrical and Computer Engineering and Physics Associate Director Nano Tech Center Texas Tech University. The Pledge of Allegiance.
E N D
The Pledge, The Peacock, & You Tim Dallas, Ph.D. Assistant Professor of Electrical and Computer Engineering and Physics Associate Director Nano Tech Center Texas Tech University
The Pledge of Allegiance I pledge allegiance to the flag of the United States of America, And to the republic for which it stands, one nation, under God, indivisible, with liberty and justice for all.
Recent Supreme Court Ruling Supreme Court ruled that father did not have legal standing to sue on behalf of his daughter. Supreme Court did not rule on whether Pledge with “under God” is unconstitutional. Elk Grove Unified School District v. Newdow, 02-1624
So…are we under God or not? Yes No Skip the pledge (or at least part of it) and play golf Sunday morning. Maybe we should care what a Supreme Being thinks… …especially if He had some of His “opinions” written down.
Current world view • Existence of a Supreme Being(s) is treated as: • Dependent on personal opinion • Based on cultural biases In theory, everybody is entitled to their own opinion…unless it interferes with the prevailing cultural norms.
Multiculturalism • Flavor of Supreme Being(s) you believe in is mostly a function of your cultural biases. • Multiculturalism teaches that all cultures essentially have equal merit, so all religions have equal merit. Atheism teaches that this merit is equal to zero.
Opinions on Gravity You can have your own opinions on gravity, but when you jump off the top of a cliff, the only “opinion” that matters is gravity’s. The ground will end most arguments. http://www.cliff-diving.ch/gallery/index.htm
Big Question Is there evidence for a Supreme Being, a.k.a. GOD?
What proof would you accept for the existence of a Supreme Being? • Historical arguments • Writing in the clouds • A loud booming voice coming from above • Philosophical arguments • Theological arguments • A resurrection from the dead • Personal experiences • Complex biological entities
Studying the Bible Historical Theological / Philosophical Prophetic Arguments • Archeology • Believability of witnesses • Transmission of information process • Relationship between ideas and empirical evidence from life • Comparison to other religions • Did past writing accurately predict future events? Scientific Christians have shied away from the…
Jesus Creator He is the image of the invisible God, the firstborn over all creation. For by Him all things were created that are in heaven and that are on earth, visible and invisible, whether thrones or dominions or principalities or powers. All things were created through Him and for Him. And He is before all things, and in Him all things consist. Colossians 1:15 – 17
Studying the “Invisible” Enter the world of Nanotechnology and Nanobiology Nanotubes DNA Chromosomes Digital Instruments & The Nanotube Site
Nanobiology Nanoscale biological structures that allow macroscale phenomena What is nanoscale?
Microscale Human Hair Red Blood Cell 0.05 mm 0.005 mm
Seeing the Invisible Transistor Silicon Individual Silicon atoms a ~ 0.0000005 mm
Proof of God? The heavens declare the glory of GOD, and the firmament shows his handiwork. Day unto day utters speech, and night unto night shows knowledge. Psalm 19:1-2
Biology at the Nanoscale • Peacock feathers • Gecko Feet • Blood Clotting • DNA http://gretchin.packetwarp.com/pix http://www.emeraldexotics.net/Gekko_gecko.html
Peacock Feathers Coloration strategies in peacock feathers Jian Zi *, Xindi Yu, Yizhou Li, Xinhua Hu, Chun Xu, Xingjun Wang, Xiaohan Liu *, and Rongtang Fu Surface Physics Laboratory (National Key Laboratory) and T-Center for Life Sciences, Fudan University, Shanghai 200433, People’s Republic of China August 26, 2003 (received for review May 31, 2003) We report the mechanism of color production in peacock feathers. We find that the cortex in differently colored barbules, which contains a 2D photonic-crystal structure, is responsible for coloration. Simulations reveal that the photonic-crystal structure possesses a partial photonic bandgap along the direction normal to the cortex surface, for frequencies within which light is strongly reflected. Coloration strategies in peacock feathers are very ingenious and simple: controlling the lattice constant and the number of periods in the photonic-crystal structure. Varying the lattice constant produces diversified colors. The reduction of the number of periods brings additional colors, causing mixed coloration. 1. J. Zi et al., Proc. Natl. Acad. Sci. U.S.A. 100, 12576 (2003)
What our eyes see 1. J. Zi et al., Proc. Natl. Acad. Sci. U.S.A. 100, 12576 (2003)
What electron microscopes see 0.0005 mm 1. J. Zi et al., Proc. Natl. Acad. Sci. U.S.A. 100, 12576 (2003)
Photonic Crystals Photonic crystal Multiple colors in One color out Essentially a color filter
Photonic Crystals Photonic crystal Multiple colors in One color out Essentially a color filter
Photonic Crystals • Widely researched topic in physics and materials science. Many potential uses. • ISI Web of Science database shows 2310 journal articles containing phrase “Photonic Crystal.” Bottom Line: Peacocks must be smarter than we thought. http://www.usarags.com/Screens_Key/Wild_Animals/ pages/3705%20Peacock.htm
The Gecko Antigravity Device http://robotics.eecs.berkeley.edu/~ronf/GECKO/
Gecko Feet No I don’t star in Geico commercials. You have me confused with my brother.
- - - - - The Gecko’s Secret “The geckos' secret is millions of microscopic hairs on the pads of their feet. Each hair, or seta, provides a miniscule adhesive force called van der Waals, which operate over very small distances but bond to just about anything.” Ceiling + + + + + Discovered in 2000 Van der Waal Bonds Seta Gecko Foot “Since geckos have millionsof these hairs on each foot, their combined adhesive force is hundreds of times greater than what is required for the gecko to hang from a ceiling by one foot.” http://news.nationalgeographic.com/news/2003/06/0602_030602_geckotape.html
Blood Clotting Fibrin protein meshwork of a clot Red Blood cell M. Behe, Darwin’s Black Box, p. 80 Manfred Kage/Peter Arnold, Inc.
Blood Clotting Where does this mesh come from? ??? What happens if a body can’t produce this mesh?
Blood Clotting Mechanism Essentially cascade of protein interactions. M. Behe, Darwin’s Black Box, p. 82
Hemophilia When Band Aids don’t work… Hemophiliacs are deficient in this single protein M. Behe, Darwin’s Black Box, p. 82
Missing a protein? Cause: One mistake in DNA Good News: Most of the time, DNA “works.”
DNA: The Language of Life Human DNA: 3,000,000,000 Base Pairs CTAGACTGGCTAGCTAGCTAACGATAGCTAGCTAGAATGCTAGCTAGAAACTGGATGGCTAGGATTGCGGATTCGGTATAGGCGATCGATGATCGATCGATGCTAGCTAGCTAGCTAGTA…………………………..2.9999997 Billionomitted ...GCTAGATCGAGCTAGCTAGCTTAGCGAGGATCGGATCGGATTTAGCGAGAGAGCGAGAGTAGATCGATCGATAGCTTAGCTAGATCGATCGTAGATCGTAGCTGGCAAGCAAAGCGGATC
Big Question Could all of these examples and everything else have come about randomly?
God’s Wisdom To Him who by wisdom made the heavens, For His mercy endures forever; To Him who laid out the earth above the waters, For His mercy endures forever; Psalm 136:5 - 6
God’s Wisdom Thus says God the LORD, Who created the heavens and stretched them out, Who spread forth the earth and that which comes from it, Who gives breath to the people on it, And spirit to those who walk on it: Isaiah 42:5
Earthly Wisdom Where is the wise? Where is the scribe? Where is the disputer of this age? Has not God made foolish the wisdom of this world? For since, in the wisdom of God, the world through wisdom did not know God, it pleased God through the foolishness of the message preached to save those who believe. 1 Corinthians 1:20-21
False Wisdom will Perish Thus you shall say to them: "The gods that have not made the heavens and the earth shall perish from the earth and from under these heavens." He has made the earth by His power, He has established the world by His wisdom, And has stretched out the heavens at His discretion. Jeremiah 10:11
Why does Creation matter to Christians (YOU!)? • Bible must be wrong or severely misunderstood if creation is a false concept. • If creation is false, Jesus is the product of mindless, purposeless processes just like everybody else. He’s not God and didn’t accomplish anything except for telling some nice stories and then dying in a brutal and public way.
Why does Creation matter to Christians? • Morals are only opinions due to chemical reactions in the brain. • Sin is a relative quantity based on cultural biases and personal beliefs. • You have no soul or spirit. You’re only chemicals. • Heaven and hell are fairy tales.
Christians need to know that… • Science can explain many biological mechanisms. • Science has not explained the origins of these mechanisms. • Science has not disproved anyaspect of the Bible.
No Excuses For since the creation of the world His invisible attributes are clearly seen, being understood by the the things that are made, even His eternal power and Godhead, so that they were without excuse. Roman 1:20
Bottom Line We are… “under GOD.”
Questions Email: tim.dallas@coe.ttu.edu Web: www.ee.ttu.edu/dallas