N-120: Spatial Characterization of the Prokaryotic Community Structure in the Passalid Beetle Gut using a High-Density

1. FG MG AHG PHG N-120: Spatial Characterization of the Prokaryotic Community Structure in the Passalid Beetle Gut using a High-Density 16S rRNA PhyloChip E. L. Brodie1,2, N. Nguyen3, T. Z. DeSantis1,2, S. Gross4, S.-O. Suh4, J. B. Nardi5, T. D. Bruns3, M. M. Blackwell4, G. L. Andersen1,2 1Lawrence Berkeley National Lab, Berkeley, CA, 2Virtual Institute of Microbial Stress and Survival, Berkeley, CA, 3University of California, Berkeley, CA, 4Louisiana State University, Baton Rouge, LA, 5University of Illinois, Urbana, IL. Email: elbrodie@lbl.gov INTRODUCTION METHODS RESULTS RESULTS Understanding the microbial processes by which wood ingesting insects derive energy may aid large-scale conversion of lignocellulosic biomass into biofuel. We examined the prokaryotic biome of the wood-injesting passalid beetle, Odontotaenius disjunctus with a 500,000-probe PhyloChip targeting multiple unique regions of the 16S rRNA gene. The passalid beetle has developed a symbiotic relationship with microbes to survive on a low-nitrogen diet that requires microbial community-derived enzymes to digest the complex polysaccharides and lignins of plant cell walls. Living passalid adults were fed fresh hardwood chips for over one month before aseptic dissection of the gut and separation into the four sections. This was carried out for four individuals. Sections were preserved in RNAlater followed by overnight storage at 4˚C. DNA and RNA were co-extracted using the All-Prep DNA/RNA purification kit (Qiagen, CA). The 16S rRNA gene was amplified from gDNA extracts using modified (degeneracies removed) universal primers 27F (5’ AGAGTTTGATCCTGGCTCAG) and 1492R (5’ GGTTACCTTGTTACGACTT) for Bacteria and 4Fa (5’ TCCGGTTGATCCTGCCRG 3’) combined with 1492R for Archaea. 500 ng of bacterial and 100 ng of archaeal 16S rRNA gene amplicons were fragmented, labeled and hybridized to a custom Affymetrix GeneChip (PhyloChip) as described previously (5). Nitrogen PhyloChip intensity (arbitrary units) FG PhyloChip intensity (arbitrary units) MG AHG PHG Figure 7. Relative intensity (abundance) of select organisms related to nitrogen flow through passalid gut. The adult gut of this approximately 3 cm beetle is over 10 cm in length and consists of four morphologically distinct sections: • Nitrogen fixation may be mediated by different organisms depending on gut region (Rhizobiales in FG, Spirochetes in AHG) • Both aerobic (Nitrosomonas) and anaerobic (Annamox planctomycetes) ammonia oxidation may be occurring in the same gut regions Figure 5. Hierarchical cluster analysis of similarity of prokaryotic species detected in passalid gut regions. Inset shows a second dendrogram and heatplot based on array intensity (relative abundance of taxa). • Foregut and anterior hindgut have distinct microbial populations • Midgut and posterior hindgut have less distinct populations CONCLUSIONS Figure 1.Odontotaenius disjunctus. Foregut (FG), midgut (MG), anterior hindgut (AHG), posterior hindgut (PHG). The fungal composition of these gut regions has been extensively studied (e.g. 1-3), and microcopy has demonstrated a morphologically-diverse bacterial population in the hindgut (4). Relatively little, however, is known about the prokaryotic diversity, which likely contributes key enzymes for lignocellulose processing in addition to fixing atmospheric nitrogen for host nutrition. To perform an in-depth census of the prokaryotic composition of each gut region we used a high-density (500,000 probe) 16S rRNA microarray (PhyloChip) to screen for the presence and relative abundance of most known prokaryotes in a massively-parallel assay. Nutrient cycling implications of PhyloChip community data This study represents the first comprehensive view of the passalid beetle gut prokaryotic population. It has revealed a diverse community that is compartmentalized in terms of composition and likely function. The co-occurrence of anaerobic and aerobic processes within gut regions suggests existence of oxygen and/or hydrogen gradients along which microbial species partition themselves. Figure 3. Schematic of PhyloChip process Carbon RESULTS Figure 2. Spatial arrangement of passalid beetle gut, showing morphologically distinct sections. PhyloChip intensity (arbitrary units) • Bacterial richness declines through the passalid gut • Archaea were detected only in anterior hindgut (AHG) ACKNOWLEDGMENTS PhyloChip intensity (arbitrary units) This work was partially supported by the National Science Foundation, Biodiversity Surveys and Inventories Program (DEB-0072741 and DEB-0417180) and REU supplements (to MB) and use of the LSU DNA sequencing facility was supported by a NSF Multi-user Equipment Grant (DBI-0400797). Part of this work was performed under the auspices of the US Department of Energy by the University of California, Lawrence Berkeley National Laboratory under Contract No. DE-AC02-05CH11231. Figure 6. Relative intensity (abundance) of select organisms related to carbon flow through passalid gut. BIBLIOGRAPHY • Methanogens (hydrogenotrophic and acetoclastic) are located in the AHG • Presence of ANME-1 archaea suggests anaerobic methane oxidation may be occurring in AHG also • Cellulose-degrading actinomycetes are present in all gut regions • Fermentative Clostridia and Bacteroidetes are present in all regions but are enriched in the AHG. Some strains are known homoacetogens. 1. Nguyen, N. H., S.-O. Suh, C. J. Marshall, and M. Blackwell. Morphological and ecological similarities: wood-boring beetles associated with novel xylose-fermenting yeasts, Spathaspora passalidarum gen. nov., sp. nov. and Candida jeffriesii sp. nov. Mycological Research. 110:1232-1241. 2. Blackwell, M., S.-O. Suh, and J. B Nardi. 2007. Fungi in the Hidden Environment: The gut of beetles. In: British Mycological Symposia: Fungi in the Environment. Eds. G. M. Gadd, S. C. Watkinson & P. S. Dyer. Cambridge University Press, UK, p. 357-370. 3. Suh, S.-O., J. V. McHugh, D. Pollock, and M. Blackwell. 2005. The beetle gut: a hyperdiverse source of novel yeasts. Mycological Research 109:261-265. 4. Nardi, J. B., C. M. Bee, L. A. Miller, N. H. Nguyen, S.-O. Suh, and M. Blackwell. 2006. Communities of microbes that inhabit the changing hind gut landscape of a subsocial beetle. Arthropod Structure and Development 35:57-68. 5. Brodie, E.L., DeSantis, T.Z., Joyner, D.C., Baek, S., Larsen, J.T., Andersen, G.L., Hazen, T.C., Herman, D.J., Tokunaga, T.K., Wan, J.M. and Firestone, M.K. 2006. Application of a high-density oligonucleotide microarray approach to study bacterial population dynamics during uranium reduction and reoxidation. Appl. Environ. Microbiol. 72:6288-6298. Figure 4. Numbers of bacterial (left bars) and archaeal (right bars) taxa detected in distinct gut sections across 4 passalid beetle individuals.