investigative cases l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Investigative Cases PowerPoint Presentation
Download Presentation
Investigative Cases

Loading in 2 Seconds...

play fullscreen
1 / 30

Investigative Cases - PowerPoint PPT Presentation


  • 171 Views
  • Uploaded on

Investigative Cases. BioQUEST Summer Workshop 2005. Joyce Cadwallader Robin Greenler Stacey Kiser Ethel Stanley .

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Investigative Cases' - Leo


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
investigative cases

Investigative Cases

BioQUEST Summer Workshop 2005

Joyce Cadwallader Robin Greenler

Stacey Kiser Ethel Stanley

>NY-99flamingoCCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT

>NY-99equineCCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT

slide2

The Rumor

Author:

Stacey Kiser, Lane CC bioquest.org/lifelines

"I read on the Internet that you can get Mad Cow Disease from Altoids."

slide4

What do you think this case is about?

What do you already know that relates to this case?

What do you need to know to understand the case?

How might this case be used to encourage students to use an interdisciplinary approach to problem solving?

slide5

NSF recommends that faculty:

  • “Build into every course inquiry*, the processes of science, a knowledge of what practitioners do, and the excitement of cutting edge research.”
  • “involving the student in asking questions and finding answers”
  • Shaping the Future: New Expectations for Undergraduate Education in Science, Mathematics, Engineering and Technology NSF, 1996. (p. 53)
cases definition
Cases: Definition

A case study is a narrative - often with characters facing decisions or a dilemma.

A case defines a problem space that learners will investigate.

elements in common
All use realistically complex problems

All are multidisciplinary

All ask learners to consider the events, decisions, facts

Elements in Common
investigative case based learning icbl
Investigative Case Based Learning: ICBL
  • ICBL blends two established methods : cases and scientific inquiry
    • The cases provide a context.
    • Students engage in investigations related to the case. This includes lab, field, and computer activities.
  • Instruction is organized around the BioQUEST 3Ps.
icbl and the 3ps
ICBL and the 3Ps
  • Problem Posing
    • Read case and analyze
    • Learn more in resources
    • Figure out questions to investigate
  • Problem Solving
    • Develop or use methods to answer questions
    • Use field, lab, computer simulations to inquire
  • Peer Persuasion
    • Present results – many possible formats!
slide14

Using Bioinformatics for Researching Epidemiology

http://bioquest.org/lifelines/biotech2003/llol_project_template.php?project_id=45

slide15

>Russia-63 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCCGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG

>Azerbaijan-67 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCGACTCAGGCAGGGAGATTTAGCATCACTCCTGCGGCGCCTTCATACACACTAAAACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCACGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG

>Azerbaijan-70 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCGACTCAGGCAGGGAGATTTAGCATCACTCCTGCGGCGCCTTCATACACACTAAAACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCACGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG

>India-55 CCGACTACAGTCGAATCGCATGGCATCTACTCAACACAGCAGGGCGCCACTCAAGCAGGCCGGTTCAGCATAACTCCAGCCGCGCCATCATACACTCTAAAGCTTGGGGAATATGGAGAAGTCACTGTGGACTGCGAGCCCCGCTCGGGCATAGACACAAACGCGTACTATGTGATGACAGTTGGGACGAAGACGTTTCTAGTCCACCGAGAATGGTTCATGGACCT

>Israel-98 CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT

>Italy-98 CCAACCACTGTGGAGTCGCATGGAAACTACTCCACACAGATTGGGGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAAGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACTAATGCCTACTACGTGATGACTGTTGGAACAAAGACGTTTTTGGTCCATCGTGAGTGGTTCATGGACCT

>Morocco-96 CCAACCACTGTTGAGTCTCATGGTAACTACTCCACACAGATTGGGGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAAGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCCTACTACGTGATGACTGTTGGAACAAAGACGTTTTTGGTCCATCGTGAGTGGTTCATGGACCT

>NY-99flamingo CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT

>NY-99equine CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT

>Romania-96 CCAACCACTGTGGAGTCGCATGGAAACTACTCCACACAGATTGGGGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAAGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCTTACTACGTGATGACTGTTGGAACAAAGACGTTTTTGGTCCATCGTGAGTGGTTCATGGACCT

>Connecticut-99 CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCAGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT

slide19

Angela sighed as she held a copy of Derrick’s Malaise. “I’m supposed to come up with my own problems for study in this bio course?” she asked no one in particular.

She re-read the short case.

slide20

“What caused Derrick’s malaria?” Angela thought. The only thing Angela knew about malaria was that people got it when they lived in other countries.

slide21

Angela noticed other students going to the computers or leafing through books at the front of the room. She decided to go to a computer herself.

Using Google, she looked up malaria and found the Mosquito Bytes site.

slide22

When the teacher walked by, he saw this on Angela’s screen.

http://whyfiles.org/016skeeter/malaria2.html

slide23

Do you think Angela is a good student?

How could we help her?

Student Notes for Using Cases

http://serc.carleton.edu/files/introgeo/icbl/CaseUserNotes.doc

slide24

Implementation and Developing Assessment Strategies

http://serc.carleton.edu/introgeo/icbl/index.html

slide26

Finding Cases

Microbes Count! 2003.

ASM Press

Biological Inquiry: A Workbook of Investigative Cases. 2005.

Benjamin Cummings

finding cases http ublib buffalo edu libraries projects cases case html
Finding Caseshttp://ublib.buffalo.edu/libraries/projects/cases/case.html
slide30

Photo credits for opening page

http://www.foothill.fhda.edu/bio/programs/bioinfo/images/micro1.jpg

Bioinformatics program at Foothills College, CA