1 / 17

Central Dogma

The following table represents the number of bacteria, algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

vita
Download Presentation

Central Dogma

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. The following table represents the number of bacteria, algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water. 2. If the number of bacteria continued to increase at the same rate as the pond continued to warm, what would the measurement be at 30 degrees? A. 400
B. 640
C. 860
D. 1270 3. Based on the information presented, the number of which of the following substances is not determined by the pond's temperature? A. Bacteria
B. Fungi
C. Algae
D. Viruses • 1. According to the information provided in the table, the number of which of the following substances is constant after a pond reaches a temperature of about 20 degrees? • Bacteria • B. Fungi
C. Algae • D. Virus

  2. Central Dogma How dna becomes you

  3. Central Dogma • The idea that DNA is a code that dictates who you are.

  4. Transcription • DNA gets rewritten into RNA DNA Strand RNA Strand

  5. RNA • Ribonucleic Acid • Single Strand • Has Uracil instead of Thymine • Nitrogenous Bases: A, C, U, G

  6. Transcription • -Occurs in Nucleus • -RNA Polymerase makes the RNA

  7. Transcription Practice RNA: A – U C – G • DNA Strand: A T G G T C C • RNA Strand:

  8. Transcription Practice • DNA STRAND: • A T G T A T G A T C C G A C G T G • RNA STRAND:

  9. Translation • “Translates” RNA sequences into amino-acid chains • Amino Acid Chains make up proteins Protein Chain RNA

  10. Translating • Split RNA sequence into sets of three bases (triplet-codons) • AUGCGCAAUCAG • AUG | CGC | AAU | CAG

  11. Translating • AUG | CGC | AAU | CAG

  12. Translate this sequence (as a group) • AUGUAGCCGCCCTGA

  13. Translate this sequence (at your table) • AUGGGGAAAUAGUUACCG

  14. SNORK ACtivity • You will make your own SNORK based on the genetic code given • Transcribe the sequence into RNA • Translate the sequence into an amino-acid chain • Find what A.A. sequence codes for what trait

  15. Graph this data. Use what ever graph you think to be the correct one.

  16. Transcribe and translate this into an amino acid chain • TACGGCTTTGATCGCGGGCTGATA • (First pair to get it right gets a treat!)

  17. Reverse translate and transcribe this sequence • MET – PHE – TYR – ALA – HIS – GLU – GLY • (First pair to get it right gets a treat!)

More Related