The following table represents the number of bacteria, algae, viruses, and fungi in a pond at differ...
This presentation is the property of its rightful owner.
Sponsored Links
1 / 17

Central Dogma PowerPoint PPT Presentation


  • 101 Views
  • Uploaded on
  • Presentation posted in: General

The following table represents the number of bacteria, algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

Download Presentation

Central Dogma

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Central dogma

The following table represents the number of bacteria, algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

2. If the number of bacteria continued to increase at the same rate as the pond continued to warm, what would the measurement be at 30 degrees?

A. 400
B. 640
C. 860
D. 1270

3. Based on the information presented, the number of which of the following substances is not determined by the pond's temperature?

A. Bacteria
B. Fungi
C. Algae
D. Viruses

  • 1. According to the information provided in the table, the number of which of the following substances is constant after a pond reaches a temperature of about 20 degrees?

  • Bacteria

  • B. Fungi
C. Algae

  • D. Virus


Central dogma

Central Dogma

How dna becomes you


Central dogma1

Central Dogma

  • The idea that DNA is a code that dictates who you are.


Transcription

Transcription

  • DNA gets rewritten into RNA

DNA Strand

RNA Strand


Central dogma

RNA

  • Ribonucleic Acid

  • Single Strand

  • Has Uracil instead of Thymine

  • Nitrogenous Bases: A, C, U, G


Transcription1

Transcription

  • -Occurs in Nucleus

  • -RNA Polymerase makes the RNA


Transcription practice

Transcription Practice

RNA:

A – U

C – G

  • DNA Strand: A T G G T C C

  • RNA Strand:


Transcription practice1

Transcription Practice

  • DNA STRAND:

  • A T G T A T G A T C C G A C G T G

  • RNA STRAND:


Translation

Translation

  • “Translates” RNA sequences into amino-acid chains

  • Amino Acid Chains make up proteins

Protein Chain

RNA


Translating

Translating

  • Split RNA sequence into sets of three bases (triplet-codons)

  • AUGCGCAAUCAG

  • AUG | CGC | AAU | CAG


Translating1

Translating

  • AUG | CGC | AAU | CAG


Translate this sequence as a group

Translate this sequence (as a group)

  • AUGUAGCCGCCCTGA


Translate this sequence at your table

Translate this sequence (at your table)

  • AUGGGGAAAUAGUUACCG


Snork activity

SNORK ACtivity

  • You will make your own SNORK based on the genetic code given

  • Transcribe the sequence into RNA

  • Translate the sequence into an amino-acid chain

  • Find what A.A. sequence codes for what trait


Central dogma

Graph this data. Use what ever graph you think to be the correct one.


Transcribe and translate this into an amino acid chain

Transcribe and translate this into an amino acid chain

  • TACGGCTTTGATCGCGGGCTGATA

  • (First pair to get it right gets a treat!)


Reverse translate and transcribe this sequence

Reverse translate and transcribe this sequence

  • MET – PHE – TYR – ALA – HIS – GLU – GLY

  • (First pair to get it right gets a treat!)


  • Login