The following table represents the number of bacteria, algae, viruses, and fungi in a pond at differ...
Download
1 / 17

Central Dogma - PowerPoint PPT Presentation


  • 149 Views
  • Uploaded on

The following table represents the number of bacteria, algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Central Dogma' - vita


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

The following table represents the number of bacteria, algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

2. If the number of bacteria continued to increase at the same rate as the pond continued to warm, what would the measurement be at 30 degrees?

A. 400
B. 640
C. 860
D. 1270

3. Based on the information presented, the number of which of the following substances is not determined by the pond's temperature?

A. Bacteria
B. Fungi
C. Algae
D. Viruses

  • 1. According to the information provided in the table, the number of which of the following substances is constant after a pond reaches a temperature of about 20 degrees?

  • Bacteria

  • B. Fungi
C. Algae

  • D. Virus


Central dogma

Central Dogma algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

How dna becomes you


Central dogma1
Central Dogma algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

  • The idea that DNA is a code that dictates who you are.


Transcription
Transcription algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

  • DNA gets rewritten into RNA

DNA Strand

RNA Strand


RNA algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

  • Ribonucleic Acid

  • Single Strand

  • Has Uracil instead of Thymine

  • Nitrogenous Bases: A, C, U, G


Transcription1
Transcription algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

  • -Occurs in Nucleus

  • -RNA Polymerase makes the RNA


Transcription practice
Transcription Practice algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

RNA:

A – U

C – G

  • DNA Strand: A T G G T C C

  • RNA Strand:


Transcription practice1
Transcription Practice algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

  • DNA STRAND:

  • A T G T A T G A T C C G A C G T G

  • RNA STRAND:


Translation
Translation algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

  • “Translates” RNA sequences into amino-acid chains

  • Amino Acid Chains make up proteins

Protein Chain

RNA


Translating
Translating algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

  • Split RNA sequence into sets of three bases (triplet-codons)

  • AUGCGCAAUCAG

  • AUG | CGC | AAU | CAG


Translating1
Translating algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

  • AUG | CGC | AAU | CAG


Translate this sequence as a group
Translate this sequence (as a group) algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

  • AUGUAGCCGCCCTGA


Translate this sequence at your table
Translate this sequence (at your table) algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

  • AUGGGGAAAUAGUUACCG


Snork activity
SNORK algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.ACtivity

  • You will make your own SNORK based on the genetic code given

  • Transcribe the sequence into RNA

  • Translate the sequence into an amino-acid chain

  • Find what A.A. sequence codes for what trait



Transcribe and translate this into an amino acid chain
Transcribe and translate this into an amino acid chain correct one.

  • TACGGCTTTGATCGCGGGCTGATA

  • (First pair to get it right gets a treat!)


Reverse translate and transcribe this sequence
Reverse translate and transcribe this sequence correct one.

  • MET – PHE – TYR – ALA – HIS – GLU – GLY

  • (First pair to get it right gets a treat!)


ad