Transcription and translation
This presentation is the property of its rightful owner.
Sponsored Links
1 / 17

Transcription and Translation PowerPoint PPT Presentation


  • 44 Views
  • Uploaded on
  • Presentation posted in: General

Transcription and Translation. Protein Structure. Made up of amino acids Polypeptide - string of amino acids bonded together (peptide bonds) Enzymes are proteins 20 amino acids are arranged in different orders to make a variety of proteins Assembled on a ribosome.

Download Presentation

Transcription and Translation

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Transcription and translation

Transcription and Translation


Protein structure

Protein Structure

  • Made up of amino acids

  • Polypeptide- string of amino acids bonded together (peptide bonds)

    • Enzymes are proteins

  • 20 amino acids are arranged in different orders to make a variety of proteins

  • Assembled on a ribosome


Transcription and translation an overview

Transcription and Translation: An Overview

Transcription

Translation


Rna vs dna

DNA

Double stranded

Deoxyribose sugar

Bases: C,G A,T

RNA

Single stranded

Ribose sugar

Bases: C,G,A,U

RNA vs. DNA


Transcription

Transcription

  • mRNA from DNA

  • mRNA’s bases are complementary to that of DNA

    • C-G

    • A-U

    • NOTICE: Uracil replaces Thymine

  • Occurs in nucleus


Major players in transcription

Major players in transcription

  • RNA polymerase-

    • Unwind DNA sequence

    • mRNA is synthesized using 1 strand of DNA (template strand)

    • Long chain of mRNA nucleotides are createdbases complementary to the DNA template


Transcription1

TRANSCRIPTION

ACGATACCCTGACGAGCGTTAGCTATCG

GGG

ACU

UGC

UAU

**Each group of 3 bases of mRNA (see colors above) are called a codons


Transcription2

Transcription

  • After transcription, mRNA- now has the information to carry out protein synthesis


Transcription is done what now

Transcription is done…what now?

Now we have mRNA transcribed from the cell’s DNA.

It leaves the nucleus through a nuclear pore into the cytoplasm

Once in the cytoplasm, it finds a ribosome where translation can begin.

The mRNA code has to be read now so a protein can be “assembled”


Translation

Translation

  • Second stage of protein production

  • mRNA is on a ribosome and “read” in groups of three bases (a codon)

  • tRNA brings amino acids to the ribosome


Transcription and translation

tRNA

  • Transfer RNA (tRNA) is bound to one amino acid on one end

  • tRNAanticodon complements mRNA codon.

  • If they do not complement, the tRNA’samino acid will not be a part of the protein!


Ribosome reads the dna code

Ribosome Reads the DNA code

  • Every mRNA codon of bases encode for an amino acid (see chart handout of Amino Acids)

  • There is a Start codon(AUG) telling the ribosome where to start translation and a STOP codon ending protein synthesis


Transcription and translation

ACGATACCCTGACGAGCGTTAGCTATCG

UGC

GGG

ACUG

UAU


After all is said and done

After All Is Said and Done….

  • The amino acid sequence forms a protein

    • Leads to a particular function and phenotype (trait) in an organism

  • Proteins can be structural (forming a part of cell materials)

  • Proteins can be functional (hormones, enzymes, biochemicals)


Protein

Protein


Protein shapes vary

Protein Shapes Vary

Amylase – an enzyme in your mouth

Hemoglobin on Red blood cells


Transcription vs translation review

Transcription

Process by which genetic information encoded in DNA is copied onto messenger RNA

Occurs in the nucleus

DNA mRNA

Translation

Process by which information encoded in mRNA is used to assemble a protein at a ribosome

Occurs on a Ribosome

mRNA protein as tRNA brings in its Amino Acid

Transcription vs. Translation Review


  • Login