Transcription and Translation

1. Transcription and Translation

2. If DNA never leaves the nucleus, how can the DNA message get to the site of protein production, the ribosome?

3. Answer: The DNA message is copied to RNA during the process of Transcription

4. How do RNA and DNA differ?

5. D. The Structure of RNA • RNA is single stranded • The sugar in RNA is Ribose, not deoxyribose as in DNA • The DNA nucleotide thymine is replaced by the RNA nucleotide Uracil

6. E. RNA’s Functions: Two Types, Two Jobs • m-RNA (messenger RNA) delivers the copied DNA from the nucleus to the Ribosome- the site of protein synthesis • t-RNA (transfer RNA) picks up specific amino acids in the cytoplasm and delivers them to the ribosome

7. Ribosome

8. F. Steps in Protein Synthesis • DNA molecule unzip where the desired gene is located • Free floating RNA nucleotides pair with the DNA strand forming m-RNA (Transcription) • The m-RNA leaves the nucleus and goes to a ribosome • A specific t-RNA delivers a specific amino acid to the ribosome (Translation) • The m-RNA codon matches with the t-RNA anticodon bringing the amino acid into its proper place • When the next amino acid is in place, the two are joined in a condensation reaction • The process is repeated until a stop code is read and a complete protein is formed

9. DNA STRAND: TACAGTGGCCTAGATCATATT

10. G. Mutation- change in the genetic code 1. Gene Mutation or Point Mutation- a nucleotide base is added, subtracted or changed to produce a change in the amino acid sequence of a protein

11. A change in a single base in the DNA strand will result in a change in the m-RNA strand and the resulting protein Normal Hemoglobin Amino Acids DNA RNA 5 6 7 GGA CTC CTC CCU GAG GAG Proline Glutamic Acid Glutamic Acid Sickle Cell Hemoglobin Proline Valine Glutamic Acid GGA CAC CTC CCU GUG GAG

14. 2. Chromosome Mutation- involves a change in many genes a) Deletion- part of a chromosome is lost b) Inversion- part of a chromosome is flipped around c) Translocation- part of a chromosome is added to another chromosome

15. 3. Somatic & Germ Mutations a) Somatic mutations: change that occurs in body cells. Affects only the individual. Ie. cancer b) Germ Mutations- changed in the genetic code of gametes that will affect the individuals offspring 4. Mutagens- substances capable of causing damage to DNA 5. Most mutations are harmful

16. 6. Frame Shift Mutations • An insertion or deletion that results in the reading frame being shifted. • All codons following the mutation will be changed. • Example: THE RED DOG ATE THE CAT HER EDD OGA TET HEC AT