Dynamics of Genes in Populations

1. Dynamics of Genes in Populations Dan Graur

2. Basic Definitions

3. A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part of the long arm of chromosome 21. 2. Homology: e.g., the alcohol dehydrogenase locus.

4. Alternative forms at a locus are called alleles.

5. allele 1 AACTTGGGTACTAGGCATTCAAGTGTG allele 2 AACTTGGGTACTTGGCATTCAAGTGTG

6. Humans are diploid organisms. Each person has two alleles at each autosomal locus. A female has two alleles at all loci. The allelic makeup at a locus is called the genotype.

7. A population is a group of individuals among which gene flow may occur, and whose offspring have on average the same fitness as their parents. 7

8. In a population, more than one allele may be present at a locus. monomorphic polymorphic

9. Each allele may be defined by its frequency.

10. Population size = 10, Ploidy = 2 Number of alleles = Population size  Ploidy Number of alleles = 10  2 = 20

11. Number of black mice = 8 Number of white mice = 2

12. Number of homozygotes = 6 Number of heterozygotes = 4

13. white allele frequency = 8/20 = 0.4

14. The set of all alleles existing in a population at all loci is called the gene pool.

15. Gene pool = Static description True for 4/4/2004 at 12:45:56 PM

16. Gene pool = Dynamic description Add a time component, and the static description becomes a dynamic description.

17. What is evolution?

18. Evolution: A process of change in a certain direction. A process of gradual and peaceful advance. The historical development of a biological group. A theory that the various types of animals and plants have their origin in other preexisting types and that the distinguishable differences are due to modifications in successive generations.

19. Evolution: A gradual process in which something changes into a different and usually more complex or better form. Change in the genetic composition of a population as a result of natural selection… and resulting in the development of new species. The historical development of a related group of organisms

20. Evolution = A change in the composition of the gene pool. evolution = gene pool + time

21. Possible Changes: 1. allele frequencies 2. genotype frequencies 1. 2.

22. Changes in allele frequencies are important. Changes in genotype frequencies are not so important. 1. 2.

23. One of the aims of the molecular evolution discipline is to study the factors affecting allele and genotype frequencies.

24. Or: Define the conditions under which no change in allele or genotype frequencies occur. Sine qua non

25. Punnett Square (1875-1967)

26. Allele frequencies are the same in sperm and ova.

27. The probability of a certain sperm fertilizing a certain ovum is equal for all sperms and ova.

28. 1908 Godfrey Harold Hardy Wilhelm Weinberg Hardy-Weinberg Equilibrium: p2 + 2pq + q2 = 1

29. equilibrium disequilibrium (Bruno) De Finetti Triangle

30. Allele and genotype frequencies will remain stable if: 1. all mating is totally random 2. there is no migration 3. there is no mutation 4. there is no selection 5. the population is infinitely large If these conditions are violated, a change in frequencies will occur.