1 / 45

Mechanisms of Immune Evasion by Tumors

Mechanisms of Immune Evasion by Tumors. W.H. Chambers, Ph.D. Associate Director for Basic Research University of Pittsburgh Cancer Institute Associate Professor of Pathology University of Pittsburgh School of Medicine. DCs migrate to Secondary Lymphoid Organs To Stimulate Immunity.

keagan
Download Presentation

Mechanisms of Immune Evasion by Tumors

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mechanisms of Immune Evasion by Tumors W.H. Chambers, Ph.D. Associate Director for Basic Research University of Pittsburgh Cancer Institute Associate Professor of Pathology University of Pittsburgh School of Medicine

  2. DCs migrate to Secondary Lymphoid Organs To Stimulate Immunity Tumor specific T cells migrate into tumors And mediate specific anti-tumor functions

  3. Innate capacity of lysis LGL CD3-, CD16+, CD56+, CD158+, CD161+ NK- = more HSV, more tumors NK+ IT = better prognosis

  4. NK Infiltration at Tumor SiteCorrelates with Improved Prognosis • Hepatocellular carcinoma (Taketomi 1998) p<.0001 • Adenocarcinoma Lung (Takanami 2001) p<.0002 • Laryngeal carcinoma (Gonzalez 1998) •  Cirrhosis (Kawarabayashi 2000) • Leukemia (Lowdell 2002) • Gastric carcinoma (Ishigami 2000) p<.01 • Colorectal carcinoma (Coca 1997) p<.001 • Gastric carcinoma (Takeuchi 2001) p<.05 • Squamous Cell Lung (Villegas 2002) p=.03 • Uterine Cervix (Vaquer 1990)

  5. Stellate Morphology Most Efficient APCs CD80, CD86, CD83, Class I/II, CD205, CD209 pDC, lyDCs, myDCs Promote Th1 [DC1] or Th2 [DC2] Produce IL12, IL2 DC+ IT = better prognosis

  6. Figure 8. Day 9 bone marrow derived cultures are enriched for mature DCs.FACS analyses for the indicated cell surface markers was performed on day 8 of cultures generated with GM-CSF, IL4 and FL (top panels), and on day 9 after 18-24 hrs of subculture in the absence of FL (bottom panels). Shaded area, specific Ab staining. Light area, isotype control Ab staining.

  7. DC Infiltration at Tumor SitesCorrelates with Improved Prognosis • Basal Cell (Bergefelt 1992,1994) • Melanoma (Toriyama 1993) • Cervical (Nakono 1992,1993) • Esophogeal (Furihata 1992) • Gastric (Tsujitani 1992,1993,1995) • Hodgkin’s (Alavaikko 1994) • Lung (Zeid 1993) • Tongue (Goldman and Lotze 1998) • Pancreas (Dallal and Lotze 2002) • H&N (Whiteside and Storkus 2002)

  8. Gliomas: Incidence and Prognosis • Most commonly diagnosed primary brain tumor • Include astrocytomas (>90% of gliomas), oligodendrogliomas, and ependymomas • ~15-17,000 new cases/yr in the US • ~15-17,000 deaths/yr in the US • Brain and CNS tumors: 3rd leading cause of cancer-related deaths in US males (15-34 yr); 4th leading cause of cancer-related deaths in US females (15-34 yr) • Median survival (conventional therapy) for high grade gliomas is 10-12 months

  9. The Nature and Anatomic Location of Gliomas Limits Conventional Approaches to Therapy Surgery – complete resection cannot be accomplished because of diffuse infiltratation into surrounding tissue and because of the need to preserve neurologic function Chemotherapy – affected to some extent by blood-brain-barrier, drug resistance, and by neurotoxic effects of drugs Radiotherapy – targeting difficult because of the infiltrative nature of gliomas, their relative radiation insensitivity, and the delayed radiation necrotic effects of doses sufficient to kill tumor cells

  10. The location and biology of gliomas limits the efficacy of conventional therapies

  11. Gliomas Have a Number of Mechanisms for Suppression or Evasion of the Immune System • Production of soluble suppressive factors - TGFb, IL10, sFHL • Disruption of antigen presentation – TAP deficiency, b2-M deficiency, Class I deficiency (some or all) • Elimination of effector cells – CD95L • Protection from lytic mechanisms – sCD95, CD36, CD46, CD55, CD59

  12. 9L Tumors Are Infiltrated by NK Cells, But There Are Some Surprises! NK Cells NK/T Cells T Cells

  13. Confocal Analyses Confirming Relative Infiltration of 9L Glioma by CD161bright and CD161dim Lymphocytes

  14. Table 1. Comparison of Lytic Activity of CD161+ Cells Isolated from Normal Splenocytes vs Established (Day 14) 9L Gliosarcoma CD161bright CD161dim Normal Spleen9L-DerivedNormal Spleen9L-Derived Exp. 1 50:1* 69+7.4** 41+4.1 6+0.8 1+3.0 25:1 60+3.6 ND 5+0.6 1+0.5 12.5:1 50+2.8 ND 3+2.9 3+1.3 6.25:1 33+5.4 ND 5+0.7 3+1.5 Exp. 2 50:1* 92+ 9.8** ND 30+3.8 22+6.9 25:1 81+12.4 34+4.5 21+2.4 17+2.8 12.5:1 72+ 6.8 29+5.2 14+0.6 11+0.5 6.25:1 33+10.7 24+3.0 11+6.5 11+3.5 LU30/106 20632 12 8 *E:T ratio **Percent specific cytotoxicity in 51Cr release assay

  15. Elimination or reversal of the effects of TGFb has been embraced as a means of enhancing immunity to gliomas • Constitutive expression of TGFb anti-sense results in reduced tumorigenicity • Constitutive expression of TGFb anti-sense results in enhanced immunogenicity • Treatment with TGFb anti-sense oligos results in reduced tumorigenicity • Unfortunately, clinical application has not proven effective

  16. Receptors for TGFb • Heteromeric complex • Type I - 53 kDa (2 isoforms) • Type II - 75 kDa (2 isoforms) • Type III - 300 kDa (beta-glycan) • Type II has serine-threonine kinase activity • Receptors are expressed ubiquitously

  17. TGFb 2 Type II TGFb receptor Soluble TGFb rII NK Tu NK

  18. 100:1 * 50:1 25:1 12.5:1 80 40 0 9L-TGFßsr 9L-neo 1 2 9L-TGFbsr is more susceptible to NK cell-mediated lysis than 9L-neo

  19. 25000 9L - 9L TGFßsr 20000 15000 TumorVolume (mm3) 10000 5000 0 0 10 20 30 Day Post Implantation 9L-TGFbsr is less tumorigenic than 9L

  20. 25 20 15 10 5 * * 0 0 10 20 30 9L-neo + NK depletion 9L-TGFßsr + NK depletion 9L-neo 9LTGFbsr Tumor size cm3 Days After Implantation + b sr Mediated Figure 7. Depletion of CD161 Cells Results in Reversal of the TGF Loss of Tumorigenicity. Rats were given either 9L-neo or 9L-TGF b sr coupled with either mAb 3.2.3 or an isotype control mAb. Tumor size was determined at various intervals using calipers. [P <0.05].

  21. Enhanced Survival of Rats with IC 9L-TGFbsr vs 9L-neo 120 100 80 9L-NEO Percent Survival 60 9L-TGFBsr 40 20 0 0 5 10 15 20 25 30 35 Days After Tumor Implantation

  22. What can we conclude from these experiments? • Local expression of TGFbsr reduces tumorigenicity • CD161+ cells are important in the anti-tumor effects in vivo, and their activity is regulated by TGFb • Some increase [22-40%] in survival is associated with local expression of TGFbsr

  23. DCs migrate to Secondary Lymphoid Organs To Stimulate Immunity

  24. Intra-tumoral Delivery of iDCs into Intracranial 9L Does Not Enhance Survival Yang et al., Cancer Res. 62:2583, 2002

  25. MHC Class II+ Cells Undergoing Apoptosis in 9L Tumors

  26. Table 4. Apoptosis of OX62+ Dendritic Cells in 9L Tumors Total CellsOX62+ CellsOX62+/VAD-FMK+% Apoptotic Cells 608a 39 11 28.0 627 55 10 18.0 666 47 4 8.5 666 66 3 4.5 635 32 5 15.6 818 36 4 11.1 564 30 11 36.7 695 12 5 41.6   40+15.5 21+12.7 aTotal cells tabulated using Hoescht staining of intact nuclei.

  27. What Receptor Ligand Interactions Are Responsible for Induction of Apoptosis of DC? • Soluble Factor Produced by Tumor Cells? • Tumor Cell Surface Receptor? • Extracellular Matrix Proteins? • Combination of Factors?

  28. Ethidium bromide stained RT-PCR products using iNOS specific primers Southern blotting of iNOS RT-PCR products Western blot using iNOS specific mAb

  29. Induction of Apoptosis* by HA of DC *TUNEL Assay and FITC-VAD-FMK

  30. Induction of DC Apoptosis is Based Upon CD44:HA Interactions

  31. What can we conclude from these experiments? • Intra-tumoral delivery of DC did not increase survival of 9L bearing rats even when RS was used to induce tumor apoptosis • DC in 9L undergo apoptosis as a consequence of iNOS production induced via CD44:HA interactions • Local expression of IL12 decreases DC apoptosis in 9L

  32. 3. Enhanced lysis 2. granule exocytosis apoptosis tumor 1. apoptosis Co-culture of NK Cells and DCs Results in Their Reciprocal Activation Which Induces Enhanced Anti-tumor Lytic Function Tu Fernandez et al.Nature Medicine 5:405-411 (1999). Ferlazzo G. et al, J. Exp. Med. 195:343-51, 2002. Piccioli D. et al, J. Exp. Med. 195:335-41, 2002. Gerosa F. et al, J. Exp. Med. 195:327-33, 2002

  33. Co-incubation of NK Cells and iDC Results in Enhanced Tumor Cell Lysis * * *

  34. Co-incubation of NK Cells and DC Does Not Result in Enhance Lysis of 9L Gliosarcoma * Additionally… IL4 has no effect Anti-Class I has no effect Anti-Class I: - IL4: -

  35. Based on these data, we are posing three questions:1) What NK:DC receptor:ligand interactions promote enhanced tumor cell lysis?2) Are those interactions important for promoting non-adaptive and adaptive immunity?3) Are expression and function of those receptors and ligands affected locally and/or systemically by the immunosuppressive effects of tumors?

  36. Potential receptor:ligand interactions regulating NK:DC reciprocal activation? NK Cell : DC CD2 CD58 CD11a CD50*/CD54/CD102 CD11b/CD18 CD54 CD47 CD172 CD56 CD171 TNFfl TNFfr [CD120a, -b*] CD158 MHC Class I CD159/CD94 MHC Class I CD161b,d/f Clrb/g Ly49 MHC Class I NKp30 ?

  37. Activation and inhibition receptors on NK cells that bind Ligands on DCs: Do they play a role in inducing cytotoxicity? * ** NK DC Tumor ** * *Charged residue in the TM region for docking of adaptor proteins with ITAM **ITIM – I/VXYXXL

  38. Activation and inhibition receptors on NK cells that bind Ligands on DCs: Do they play a role in inducing cytotoxicity? * ** Clrg CD161F ? NKp30 NK DC Tumor Clrb CD161A CD161B,D ** * *Charged residue in the TM region for docking of adaptor proteins with ITAM **ITIM – I/VXYXXL

  39. Are CD161-Clr Interactions Involved in the Enhanced Tumor Cell Lysis Induced NK:DC Co-culture? Strategy:RNA interference siRNA design: Dharmacon siDesign Center Motifs: 5’-AA(N19)UU; 5’-AA(N21); 5’NA(N21) Transfection method: Oligofectamine* Nucleofection Detection: Flow cytometry Northern blot/Realtime PCR Cytotoxicity Assays

  40. 5’-AA(N19)UU Motifs for Primers for siRNA for CD161s, Clrb and NKp30 ReceptorsTargeted SequenceLocationG/C Content CD161A AAGCACGTGTCTACCTCAGTT 26-44 53% CD161A AAGACTGCCGCGGGGGCTCAG 56-76 71% CD161B AAGTGGTCTATGCGGACTTAC 199-217 53% CD161B AAGCGCGAGCCACCTCCATCT (Invitrogen) 241-261 62% CD161A & -B AAAACAGGTAGTCCAGCTAAG 269-289 43% CD161A & -B AAGGAGCCACGTTGCTGCTCG 560-582 56% CD161A & -B AAGTGGATAAACGGCTCGACT 682-704 43% CD161F AAAGAGTCTATGGTAATGTAA 13-31 31% CD161F AATGCTTAATTATTTCTCAAA 311-333 17% CD161F AAGAAGCCACTTTGTTGATCA 374-396 35% CD161F AAAATGAAGAAGAACTGAAGT 398-420 26% CD161F AACTGAAGTTTGTGCAGAACA 410-432 35% CD161F AAAGGGAAGACAGCAGTTATT 435-457 35% CD161F AAGTGGATAAATGGCTCTGTT 496-518 35% Clrb/Ocil AACTGCTGCTACGTAGTGATC 411-429 53% Clrb/Ocil AACCATAAATACTTATGCTGC 498-520 30% Clrb/Ocil AAGGGGCCGAGCTAGCACGAT 614-636 56% Clrb/Ocil AAAGGGAGTTCAGGTTACTGG 673-695 43% NKp30 AAGGTGCTGTTGATCGTCTTC 312-330 53% NKp30 AAGGACATCCAAAGCCATGAC 591-609 53% NKp30 AACCGGCAGTGTCATCTATTA 794-812 47% (3 ml Oligof. + 12 ml Opti-MEM) + (3 ul 20 mM siRNA + 50 ml Opti-MEM) + 32 ml Opti-MEM Added to 500 ml cells in CM

  41. 1.0 0.98 0.51 0.49 Targeted siRNA Treatment of DCs Results in Reduced Message for Clrb: Realtime PCR

  42. NKp30 Clrg CD161F ? NK DC Tumor Clrb CD161A CD161B,D

  43. Reduction in Expression of CD161B in A-NK Cells Using siRNA Oligonucleotides Control Control siRNA Control siRNA CD161B Cell No. Mean Fluorescence Intensity

  44. What can we conclude from these experiments? • siRNA targeting of Clrb in DCs – verified by Realtime PCR • siRNA targeting of Clrb in DCs results in reduced enhancement of lytic activity against YAC-1 following A-NK:DC co-culture • siRNA targeting of CD161s in A-NK cells – verified by flow cytometry • siRNA targeting of CD161s in A-NK does not result in reduced lysis of YAC-1 • siRNA targeting of CD161B in A-NK cells results in reduced enhancement of lytic activity following A-NK:DC co-culture

  45. Mechanisms of Immune Evasion by Tumors Department of Pathology Department of Neurological Surgery William H. Chambers, Ph.D. Hideho Okada, M.D., Ph.D. Tianbing Yang, Ph.D. Ian F. Pollack, M.D. Katy Webb Department of Immunology Lorissa Figallo Sean Ryan Department of PsychologyMolecular Genetics and Biochemistry Melanie Flint, Ph.D. Paul D. Robbins, Ph.D. Dept.Cell Biol. Physiol./CBI Department of Neurobiology Simon Watkins, Ph.D.Carl Lagenaur, Ph.D. NSABP/UPCI BiostatisticsStanford University Doug Potter, Ph.D. Sheri Krams, Ph.D. John Bryant, Ph.D. Christine Hsieh

More Related