INDM 3007
Download
1 / 13

INDM 3007 - PowerPoint PPT Presentation


  • 157 Views
  • Uploaded on

INDM 3007. Lecture 9. Proteins interact with DNA: how do they know where to bind?. DNA appears to a homogenous molecule, no specific features to recognise is this true?. What is unique to a particular stretch of DNA? Local shape of DNA Nucleotide sequence.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' INDM 3007' - jed


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

INDM 3007

Lecture 9


Proteins interact with DNA: how do they know where to bind?

DNA appears to a homogenous molecule, no specific features to recognise is this true?

What is unique to a particular stretch of DNA?

Local shape of DNA

Nucleotide sequence

DNA binding proteins use these two features to recognise a particular sequence


The morphology of DNA is dependent on the DNA sequence. Some sequences introduce bends in DNA for example

These structural features are recognised by proteins, much like in the ‘lock and key model’ for enzymes

Local DNA structure

DNA is not a straight tube


The DNA helix has two ‘grooves’: sequences introduce bends in DNA for example

the major groove

the minor groove

to which proteins bind

The nucleotide bases are on the inside of the helix

DNA binding proteins do not open the helix, so what do they recognise?

DNA binding proteins ‘see’ the edges of the basepairs in the major or minor groove


The protein ‘sees’ a particular array of these, which is different for each of the four base pairs

Note that the edge pattern for G:C is different than the one for C:G

What is it that these proteins interact with:

Hydrogen bond donors

Hydrogen bond acceptors

Hydrophobic residues


These are the edge patterns a DNA binding protein would ‘see’

Notice that in the major groove, every base pair has a unique pattern, wherease the minor groove only has two distinct patterns.

The major groove is therefore more informative than the minor groove


Based on structure comparisons it turned out that many bacterial DNA binding proteins contain a conserved domain of two alpha helices: helix-turn-helix motif

What parts of the protein are involved in DNA recognition

Mutations in helix 2 prevent DNA binding, which can be suppressed by mutations in the DNA sequence of the operator

Swapping helix 2 between two different repressors also swapped the operator to which the proteins bind

This shows that helix 2 is involved in DNA recognition


Using X-Ray crystallography to determine the 3-D structures of proteins bound to DNA, the protein domains binding to DNA were revealed

Rasmol pictures

Helix 2 inserts into the major groove of DNA, whereas helix 1 lies across the groove

Helix 2 interacts with the base pair edges

Helix 1 contacts the sugar phosphate backbone

How does this work?


Specific amino acids, on the side of the helix facing DNA, interact with the base pair edges through hydrogen bonding

The number of interactions between helix 2 and the DNA sequence determines the strenghth of DNA binding.

Helix turn helix motif of Cro

repressor protein (phage Lambda)

Interaction between Cro and DNA

Explains why the same protein can bind to different, yet related sequences with different affinities. We saw this for the LysR type proteins!


helix interact with the base pair edges through hydrogen bonding

helix

GCCACTTCAGATTTCCTGAATGCCTAC

Many DNA binding proteins are dimers, e.g, the LysR type proteins and CAP

This means that there are two helix-turn-helix motifs

per dimeric protein

These will interact with two adjacent major grooves, ie 10 bp apart

(CbbR binding site, lecture 5)

The DNA recognition site is therefore frequently an inverted repeat


The helix-turn-helix motif is often employed by bacterial DNA binding proteins, but there are other motifs.

Zinc finger

Leucine zipper

Will be discussed by Patrick Caffrey

Non specific DNA binding proteins do not have sequence specific interactions with DNA. Histones for example rely on electrostatic interactions:

DNA phosphate back bone is negatively charged

Protein is positively charged.


It allows regulators binding far upstream (see lecture 5) to contact the RNA polymerase

Integration host factor, IHF, is another example of proteins that do not make use of a HTH motif to bind to DNA

This protein induces an 180o bend in the DNA

Sigma54 RNA pol


Dna protein interactions
DNA protein interactions contact the RNA polymerase

  • Proteins can bind aspecifically to DNA using electrostatic interactions, e.g. histones

  • Specific DNA interactions frequently involve a helix-turn-helix domain, but there are other domains as well

  • Helix 2 of the helix turn helix motif, the recognition helix, contacts base pairs in the major groove of DNA

  • The base edges are recognised by this helix, the DNA helix is not opened up

  • Most DNA binding proteins are dimers and bind to an inverted repeat sequence in DNA

  • Many proteins recognise the local structure of DNA, e.g, sequence induced DNA bending